Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU044981

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC7A5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAAGGCACCAAACTGGATGTGGGGAACATTGTGCTGGCATTATACAGCGGCCTCTTTGCCTATGGAGGATGGAATTACTTGAATTTCGTCACAGAGGAAATGATCAACCCCTACAGAAACCTGCCCCTGGCCATCATCATCTCCCTGCCCATCGTGACGCTGGTGTACGTGCTGACCAACCTGGCCTACTTCACCACCCTGTCCACCGAGCAGATGCTGTCGTCCGAGGCCGTGGCCGTGGACTTCGGGAACTATCACCTGGGCGTCATGTCCTGGATCATCCCCGTCTTCGTGGGCCTGTCCTGCTTCGGCTCCGTCAATGGGTCCCTGTTCACATCCTCCAGGCTCTTCTTCGTGGGGTCCCGGGAAGGCCACCTGCCCTCCATCCTCTCCATGATCCACCCACAGCTCCTCACCCCCGTGCCGTCCCTCGTGTTCACGTGTGTGATGACGCTGCTCT

N° accesso Ensembl | uomo

ENSG00000103257

N° accesso NCBI

NM_003486

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SLC7A5(8140) , SLC7A5(8140)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Keisuke Enomoto et al.
Scientific reports, 9(1), 14616-14616 (2019-10-12)
A novel therapeutic approach is urgently needed for patients with anaplastic thyroid cancer (ATC) due to its fatal and rapid progress. We recently reported that ATC highly expressed MYC protein and blocking of MYC through its selective inhibitor, JQ1, decreased
Ling Wei et al.
Cancer science, 107(3), 347-352 (2016-01-11)
3-(18)F-l-α-methyl-tyrosine ([18F]FAMT), a PET probe for tumor imaging, has advantages of high cancer-specificity and lower physiologic background. FAMT-PET has been proved useful in clinical studies for the prediction of prognosis, the assessment of therapy response and the differentiation of malignant
Yu Takahashi et al.
Pharmaceutical research, 35(12), 246-246 (2018-10-31)
The anti-epileptic drug pregabalin crosses the blood-brain barrier (BBB) in spite of its low lipophilicity. This study was performed to determine whether L-type amino acid transporters (LAT1/SLC7A5 and LAT2/SLC7A8) contribute to the uptake of pregabalin. Pregabalin uptake by LATs-transfected HEK293
Naoya Nakai et al.
Journal of cellular biochemistry, 119(2), 2094-2101 (2017-09-01)
Branched-chain amino acid supplements consumed following exercise are widely used to increase muscle mass. Although both exercise (ie, mechanical stimulation) and branched-chain amino acid leucine supplementation have been reported to stimulate muscle protein synthesis by activating the mammalian target of
Carsten Gram Hansen et al.
Cell research, 25(12), 1299-1313 (2015-11-28)
YAP and TAZ are transcriptional co-activators and function as the major effectors of the Hippo tumor suppressor pathway, which controls cell growth, tissue homeostasis, and organ size. Here we show that YAP/TAZ play an essential role in amino acid-induced mTORC1
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.