Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU043331

Sigma-Aldrich

MISSION® esiRNA

targeting human SUZ12

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAAGGCAACAAACTGAAGCAAGAGATGACCTGCATTGCCCTTGGTGTACTCTGAACTGCCGCAAACTTTATAGTTTACTCAAGCATCTTAAACTCTGCCATAGCAGATTTATCTTCAACTATGTTTATCATCCAAAAGGTGCTAGGATAGATGTTTCTATCAATGAGTGTTATGATGGCTCCTATGCAGGAAATCCTCAGGATATTCATCGCCAACCTGGATTTGCTTTTAGTCGCAACGGACCAGTTAAGAGAACACCTATCACACATATTCTTGTGTGCAGGCCAAAACGAACAAAAGCAAGCATGTCTGAATTTCTTGAATCTGAAGATGGGGAAGTAGAACAGCAAAGAACATATAGTAGTGGCCACAATCGTCTGTATTTCCATAGTGATACCTGCTTACCTCTCCGTCCACAAGAAATGGAAGTAGATAGTGAAGATGAAAAGGATCCTGAATGGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiaoli Wei et al.
Oncology letters, 18(2), 1607-1616 (2019-08-20)
Chemotherapy resistance is a major obstacle to the effective treatment of patients with gastric cancer (GC). Mounting evidence has indicated that the dysregulation of microRNAs (miRNAs) is associated with the sensitivity of cancer cells to chemotherapy. However, the mechanisms underlying
Young Hwa Soung et al.
Cancers, 12(8) (2020-08-14)
Triple-negative breast cancers (TNBCs) lack ER, PR and her2 receptors that are targets of common breast cancer therapies with poor prognosis due to their high rates of metastasis and chemoresistance. Based on our previous studies that epigenetic silencing of a
Lin Jin et al.
Cancer research, 77(20), 5464-5478 (2017-08-23)
NOTCH signaling exerts essential roles in normal and malignant intestinal physiology and the homeostasis of cancer stem-like cells (CSC), but the basis for this latter role remains obscure. The signaling scaffold protein STRAP is upregulated in several cancers, where it
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.