Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU041011

Sigma-Aldrich

MISSION® esiRNA

targeting human HPSE

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTGCAGCTGGCTTTATGTGGCTGGATAAATTGGGCCTGTCAGCCCGAATGGGAATAGAAGTGGTGATGAGGCAAGTATTCTTTGGAGCAGGAAACTACCATTTAGTGGATGAAAACTTCGATCCTTTACCTGATTATTGGCTATCTCTTCTGTTCAAGAAATTGGTGGGCACCAAGGTGTTAATGGCAAGCGTGCAAGGTTCAAAGAGAAGGAAGCTTCGAGTATACCTTCATTGCACAAACACTGACAATCCAAGGTATAAAGAAGGAGATTTAACTCTGTATGCCATAAACCTCCATAATGTCACCAAGTACTTGCGGTTACCCTATCCTTTTTCTAACAAGCAAGTGGATAAATACCTTCTAAGACCTTTGGGACCTCATGGATTACTTTCCAAATCTGTCCAACTCAATGGTCTAACTCTAAAGATGGTGGATGATCAAACCTTGCCACCTTTAATGGAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Marjolein Garsen et al.
The American journal of pathology, 186(4), 805-815 (2016-02-14)
Heparanase, a heparan sulfate (HS)--specific endoglucuronidase, mediates the onset of proteinuria and renal damage during experimental diabetic nephropathy. Glomerular heparanase expression is increased in most proteinuric diseases. Herein, we evaluated the role of heparanase in two models of experimental glomerulonephritis
Jianping Li et al.
American journal of cancer research, 7(2), 234-244 (2017-03-25)
Heparanase (HPSE1) is elevated in various types of cancers including cervical cancer, and correlated with poor prognosis. Current study is to investigate the effects of HPSE1 on radiation response in cervical cancer. Colony formation assays after radiation were performed to
Uri Barash et al.
International journal of cancer, 145(6), 1596-1608 (2019-04-30)
Heparanase is an endo-β-d-glucuronidase that cleaves heparan sulfate (HS) side chains of heparan sulfate proteoglycans. Compelling evidence tie heparanase levels with all steps of tumor formation including tumor initiation, growth, metastasis and chemo-resistance, likely involving augmentation of signaling pathways and
Haiyan Zheng et al.
Cancer biomarkers : section A of Disease markers, 15(5), 525-534 (2015-01-15)
Heparanase(HPSE), an endo-β -D-glucuronidase, is found overexpressed in Ovarian cancer (OC). The purpose of our work was to investigate primitively the possible role of HPSE in the development of OC. In this study, RNA interference (RNAi) with a HPSE small
Satvik R Hadigal et al.
Nature communications, 6, 6985-6985 (2015-04-29)
Herpesviruses exemplified by herpes simplex virus-1 (HSV-1) attach to cell surface heparan sulfate (HS) for entry into host cells. However, during a productive infection, the HS moieties on parent cells can trap newly exiting viral progenies and inhibit their release.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.