Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU037901

Sigma-Aldrich

MISSION® esiRNA

targeting human USP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGACCCTGAGATGGGCAATTTCACAATTTGCTTCAGTAGAAAGGATTGTAGGAGAAGATAAATATTTCTGTGAAAACTGCCATCATTATACTGAAGCTGAACGAAGTCTTTTGTTTGACAAAATGCCTGAAGTTATAACTATTCATTTGAAGTGCTTTGCTGCTAGTGGTTTGGAGTTTGATTGTTATGGTGGTGGACTTTCCAAGATCAACACTCCTTTATTGACACCTCTTAAATTGTCACTAGAAGAATGGAGCACAAAGCCAACTAACGACAGCTATGGATTATTTGCGGTTGTGATGCATAGTGGCATTACAATTAGTAGTGGGCATTACACTGCTTCTGTTAAAGTCACTGACCTTAACAGTTTAGAACTAGATAAAGGAAATTTTGTGGTTGACCAAATGTGTGAAATAGGTAAGCCAGAACCATTGAATGAGGAGGAAGCAAGGGGTGTGGTTGAGAAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

M Raimondi et al.
Cell cycle (Georgetown, Tex.), 15(1), 106-116 (2016-01-16)
CAPNS1 is essential for the stability and function of ubiquitous CAPN1 and CAPN2. Calpain modulates by proteolytic cleavage many cellular substrates and its activity is often deregulated in cancer cells, therefore calpain inhibition has been proposed as a therapeutical strategy
Maura Sonego et al.
Science advances, 5(5), eaav3235-eaav3235 (2019-05-16)
Resistance to platinum-based chemotherapy is a common event in patients with cancer, generally associated with tumor dissemination and metastasis. Whether platinum treatment per se activates molecular pathways linked to tumor spreading is not known. Here, we report that the ubiquitin-specific
Dana Goldbraikh et al.
EMBO reports, 21(4), e48791-e48791 (2020-03-07)
PI3K-Akt-FoxO-mTOR signaling is the central pathway controlling growth and metabolism in all cells. Ubiquitination of the protein kinase Akt prior to its phosphorylation is required for PI3K-Akt activity. Here, we found that the deubiquitinating (DUB) enzyme USP1 removes K63-linked polyubiquitin

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.