Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU037061

Sigma-Aldrich

MISSION® esiRNA

targeting human SALL4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCAGAAAGTGAGGGTGGACCCACACTCCCTGGGGTGGGACCAAACTATAATTCCCCAAGGGCTGGTGGCTTCCAAGGGAGTGGGACCCCTGAGCCAGGGTCAGAGACCCTGAAATTGCAGCAGTTGGTGGAGAACATTGACAAGGCCACCACTGATCCCAACGAATGTCTCATTTGCCACCGAGTCTTAAGCTGTCAGAGCTCCCTCAAGATGCATTATCGCACCCACACCGGGGAGAGACCGTTCCAGTGTAAGATCTGTGGCCGAGCCTTTTCTACCAAAGGTAACCTGAAGACACACCTTGGGGTTCACCGAACCAACACATCCATTAAGACGCAGCATTCGTGCCCCATCTGCCAGAAGAAGTTCACTAATGCCGTGATGCTGCAGCAACATATTCGGATGCACA

N° accesso Ensembl | uomo

ENSG00000101115

N° accesso NCBI

NM_020436

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SALL4(57167) , SALL4(57167)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kol Jia Yong et al.
Oncotarget, 7(46), 75425-75440 (2016-10-06)
The overall survival of lung cancer patients remains dismal despite the availability of targeted therapies. Oncofetal protein SALL4 is a novel cancer target. We herein report that SALL4 was aberrantly expressed in a subset of lung cancer patients with poor
Dengfeng Zhang et al.
Oncology research, 25(5), 763-771 (2016-12-17)
Sal-like protein 4 (SALL4) is a zinc finger transcription factor that has been reported to be aberrantly expressed in several human malignancies and identified as an oncogene. However, the potential role of SALL4 in osteosarcoma remains to be elucidated. In
Amireza Hesari et al.
Journal of cellular biochemistry, 120(6), 9392-9399 (2018-12-07)
Breast cancer is the most prevalent cancers worldwide and causes a significant amount of deaths annually. Spalt-like transcription factor 4 is known as a transcription factor, which has an important role in the proliferation of cancerous cells. Small interfering RNA
Mei Wang et al.
Journal of cellular biochemistry, 120(9), 15027-15037 (2019-04-23)
MicroRNAs (miRNAs) play pivotal roles in modulating key biological processes in gastric cancer (GC). As a newly identified miRNA, the function and potential mechanism of miR-188-5p in GC has not been thoroughly elucidated. Here, quantitative real-time polymerase chain reaction detection
AmirReza Hesari et al.
Journal of cellular biochemistry (2019-02-17)
Colorectal cancer (CRC) is known as the third most common malignancies among men and women and is also the second leading cause of cancer-related deaths worldwide. It has been indicated that a variety of risk factors are involved in the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.