Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU035471

Sigma-Aldrich

MISSION® esiRNA

targeting human PNPLA2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGTGCCAAGTTCATTGAGGTATCTAAAGAGGCCCGGAAGCGGTTCCTGGGCCCCCTGCACCCCTCCTTCAACCTGGTAAAGATCATCCGCAGTTTCCTGCTGAAGGTCCTGCCTGCTGATAGCCATGAGCATGCCAGTGGGCGCCTGGGCATCTCCCTGACCCGCGTGTCAGACGGCGAGAATGTCATTATATCCCACTTCAACTCCAAGGACGAGCTCATCCAGGCCAATGTCTGCAGCGGTTTCATCCCCGTGTACTGTGGGCTCATCCCTCCCTCCCTCCAGGGGGTGCGCTACGTGGATGGTGGCATTTCAGACAACCTGCCACTCTATGAGCTTAAGAACACCATCACAGTGTCCCCCTTCTCGGGCGAGAGTGACATCTGTCCGCAGGACAGCTCCACCAACATC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yosuke Kanno et al.
Arthritis research & therapy, 19(1), 22-22 (2017-02-06)
Systemic sclerosis (SSc) is a connective tissues disease of unknown origin characterized by vascular damage and extensive fibrosis. Recently, we demonstrated that α2-antiplasmin (α2AP) is associated with the development of fibrosis in SSc. We herein investigate the roles of α2AP
Monika Riederer et al.
Archives of physiology and biochemistry, 123(4), 249-253 (2017-04-04)
Vascular endothelial cells represent an important source of arachidonic acid (AA)-derived mediators involved in the generation of anti- or proatherogenic environments. Evidence emerged (in mast cells), that in addition to phospholipases, neutral lipid hydrolases as adipose triglyceride lipase (ATGL) also
Tian Ma et al.
International journal of oncology, 42(5), 1743-1753 (2013-04-03)
The G0/G1 switch gene 2 (G0S2) is rapidly induced by all-trans-retinoic acid (RA)-treatment of acute promyelocytic leukemia (APL) and other cells. G0S2 regulates lipolysis via inhibition of adipose triglyceride lipase (ATGL). This study found that retinoic acid receptor (RAR), but
Susanne Bürger et al.
International journal of molecular sciences, 22(1) (2021-01-06)
The demise of retinal ganglion cells (RGCs) is characteristic of diseases of the retina such as glaucoma and diabetic or ischemic retinopathies. Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein that mediates neuroprotection and inhibition of angiogenesis in the
Ping Xie et al.
Endocrinology, 156(5), 1648-1658 (2015-03-10)
Intramyocellular accumulation of lipids is often associated with insulin resistance. Deficiency of comparative gene identification-58 (CGI-58) causes cytosolic deposition of triglyceride (TG)-rich lipid droplets in most cell types, including muscle due to defective TG hydrolysis. It was unclear, however, whether

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.