Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU035251

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGAGGCAGGCTGTTAATGCCACTGGGCACCTTTCAGACACACTTTGGCTGATCCCCATCACATTCCTGACCATCGGCTATGGTGACGTGGTGCCGGGCACCATGTGGGGCAAGATCGTCTGCCTGTGCACTGGAGTCATGGGTGTCTGCTGCACAGCCCTGCTGGTGGCCGTGGTGGCCCGGAAGCTGGAGTTTAACAAGGCAGAGAAGCACGTGCACAACTTCATGATGGATATCCAGTATACCAAAGAGATGAAGGAGTCCGCTGCCCGAGTGCTACAAGAAGCCTGGATGTTCTACAAACATACTCGCAGGAAGGAGTCTCATGCTGCCCGCAGGCATCAGCGCAAGCTGCTGGCCGCCATCAACGCGTTCCGCCAGGTGCGGCTGAAACACCGGAAGCTCCGGGAACAAGTGAACTCCATGGTGGACATCTCCAAGATGCACATGATCCTGTATGACCTGCAGCAGA

N° accesso Ensembl | uomo

ENSG00000104783

N° accesso NCBI

NM_002250

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... KCNN4(3783) , KCNN4(3783)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
SSU
ISU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yu-Dong Fei et al.
Theranostics, 9(22), 6396-6411 (2019-10-08)
Effective therapeutic targets against post-myocardial infarction (MI) arrhythmias remain to be discovered. We aimed to investigate the role of macrophages in post-MI arrhythmias. Methods: Mononuclear cell accumulation, macrophage polarization from M0 to M1 subset, and gap junction formation were analyzed
Alban Girault et al.
Respiratory research, 16, 100-100 (2015-09-04)
Extensive alveolar epithelial injury and remodelling is a common feature of acute lung injury and acute respiratory distress syndrome (ARDS) and it has been established that epithelial regeneration, and secondary lung oedema resorption, is crucial for ARDS resolution. Much evidence
Chunling Huang et al.
Scientific reports, 6, 23884-23884 (2016-04-01)
Autophagy is emerging as an important pathway in many diseases including diabetic nephropathy. It is acknowledged that oxidative stress plays a critical role in autophagy dysfunction and diabetic nephropathy, and KCa3.1 blockade ameliorates diabetic renal fibrosis through inhibiting TGF-β1 signaling
Yu Liu et al.
Journal of Cancer, 6(7), 643-651 (2015-06-17)
The intermediate conductance calcium-activated potassium channel KCa3.1 plays an important role in regulating cell proliferation and migration. However, the role of KCa3.1 channel in human hepatocellular carcinoma remained unknown. This study was therefore performed to investigate the effects of KCa3.1
Etmar Bulk et al.
Oncotarget, 8(68), 112268-112282 (2018-01-20)
Early metastasis leads to poor prognosis of lung cancer patients, whose 5-year survival rate is only 15%. We could recently show that the Ca2+ sensitive K+ channel KCa3.1 promotes aggressive behavior of non-small cell lung cancer (NSCLC) cells and that

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.