Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU034241

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC13A2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTTCAGCCTGCACTCTTTCCCCTCCTGGGCACAGTCCAACACCACAGCCCAGTGCCTGCCAAGCCTGGCCAACACCACCACACCAAGCCCCTAGGCTGGGGCACAGCCTGGCCATGCCCAGGAAGACCCACCCCATTCCCACTCCTCTGAGCCCGGAGGGGACACCCCAAGCTCCAAGCTCCAAGCTCCAGGCCAAAGGCTGAAAGGCACGTGTGTACATAATCTCTTGCGTGTCTGTAAGGAAGGGGTGTATGCTCAGTTTCCTATGTGCTGGAATAAAAGGTGTGTGCATGTGTGTGTGCGCATATGTGTGCGCCTGCATGGATGTGAGGGGTGTGTGACGTGAGGCTATCTGAGGGGGGCTGTGTGCATGCACATGATCCTAGGTATGTATGTTGGACAGTGCACACGTGTGTGTTCACAGACAATACAACATGCCCTCTCTGGTGCCCCAGGTCTTGGTATCCCCAGCT

N° accesso Ensembl | uomo

ENSG00000007216

N° accesso NCBI

NM_003984

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SLC13A2(9058) , SLC13A2(9058)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ZAV

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Neil R Hackett et al.
PloS one, 6(5), e18378-e18378 (2011-05-17)
The human airway epithelium consists of 4 major cell types: ciliated, secretory, columnar and basal cells. During natural turnover and in response to injury, the airway basal cells function as stem/progenitor cells for the other airway cell types. The objective
Lynne Bingle et al.
Respiratory research, 8, 79-79 (2007-11-09)
Short PLUNC1 (SPLUNC1) is the founding member of a family of proteins (PLUNCS) expressed in the upper respiratory tract and oral cavity, which may function in host defence. It is one of the most highly expressed genes in the upper
Lynne Bingle et al.
Respiratory research, 7, 61-61 (2006-04-08)
The Whey Acidic Protein domain is an evolutionarily conserved motif found in a number of proteins, the best studied of which are antiproteinases involved in the innate immune defence of multiple epithelia. We recently characterised the WFDC2 gene which encodes
Lynne Bingle et al.
Histochemistry and cell biology, 138(5), 749-758 (2012-07-07)
Although the biology the PLUNC (recently renamed BPI fold, BPIF) family of secreted proteins is poorly understood, multiple array based studies have suggested that some are differentially expressed in lung diseases. We have examined the expression of BPIFB1 (LPLUNC1), the
Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.