Passa al contenuto
Merck
Tutte le immagini(2)

Documenti fondamentali

EHU032581

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACATGGAGATCAGCGTGAAGGAGTTGCGGACAATCCTCAATAGGATCATCAGCAAACACAAAGACCTGCGGACCAAGGGCTTCAGCCTAGAGTCGTGCCGCAGCATGGTGAACCTCATGGATCGTGATGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATCCTGTGGAACCGCATCCGGAATTACCTGTCCATCTTCCGGAAGTTTGACCTGGACAAGTCGGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCGGCAGGCTTCAAGCTCAACAAGAAGCTGTACGAGCTCATCATCACCCGCTACTCGGAGCCCGACCTGGCGGTCGACTTTGACAATTTCGTTTGCTGCCTGGTGCGGCTAGAGACCATGTTCCGATTTTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACTTGTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGG

N° accesso Ensembl | uomo

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

L M Yu et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(7), 924-932 (2018-12-20)
Pancreatic cancer (PC) is a highly aggressive and metastatic disease, with an elevated mortality rate. It is, therefore, crucial to assess factors affecting the prognosis of PC patients. Meanwhile, calpain-1 is associated with malignant tumor progression and metastasis. Thus, it
Meei-Ling Sheu et al.
Oncotarget, 8(12), 19376-19388 (2016-12-31)
Ochratoxin A (OTA) contaminated food increases reactive oxygen species (ROS) production in glomerulus and causes glomerulopathy. The molecular mechanisms still remain uncertain. In this study, we used mouse and rat glomerular mesangial cells and delineate the signaling pathway behind the
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this

Articoli

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.