Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU031671

Sigma-Aldrich

MISSION® esiRNA

targeting human CD81

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCAT

N° accesso Ensembl | uomo

ENSG00000110651

N° accesso NCBI

NM_004356

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CD81(975) , CD81(975)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Down-regulation of CD81 in human cells producing HCV-E1/E2 retroVLPs.
Ana F Rodrigues et al.
BMC proceedings, 5 Suppl 8, P72-P72 (2012-03-01)
Raphaël Gaudin et al.
PloS one, 8(7), e69450-e69450 (2013-08-08)
During HIV pathogenesis, infected macrophages behave as "viral reservoirs" that accumulate and retain virions within dedicated internal Virus-Containing Compartments (VCCs). The nature of VCCs remains ill characterized and controversial. Using wild-type HIV-1 and a replication-competent HIV-1 carrying GFP internal to
Zhen-yong Keck et al.
PLoS pathogens, 8(4), e1002653-e1002653 (2012-04-19)
The majority of broadly neutralizing antibodies to hepatitis C virus (HCV) are against conformational epitopes on the E2 glycoprotein. Many of them recognize overlapping epitopes in a cluster, designated as antigenic domain B, that contains residues G530 and D535. To
Chien-Te K Tseng et al.
The Journal of experimental medicine, 195(1), 43-49 (2002-01-10)
Infection with hepatitis C virus (HCV) is a leading cause of chronic liver disease worldwide. Little is known about how this virus is able to persist or whether this persistence might be because of its ability to alter the early
Zhihui Chen et al.
PloS one, 6(4), e18933-e18933 (2011-04-29)
HCV infection is often associated with B-cell regulatory control disturbance and delayed appearance of neutralizing antibodies. CD81 is a cellular receptor for HCV and can bind to HCV envelope protein 2 (E2). CD81 also participates to form a B cell
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.