Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU030221

Sigma-Aldrich

MISSION® esiRNA

targeting human SATB2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAACCAAGTGCCAGGAGTTTGGGAGATGGTATAAAAAGTACAAGAAGATTAAAGTGGAAAGAGTGGAACGAGAAAACCTTTCAGACTATTGTGTTCTGGGCCAGCGTCCAATGCATTTACCAAATATGAACCAGCTGGCATCCCTGGGGAAAACCAACGAACAGTCTCCTCACAGCCAAATTCACCACAGTACTCCAATCCGAAACCAAGTGCCCGCATTACAGCCCATCATGAGCCCTGGTCTTCTTTCTCCCCAGCTTAGTCCACAACTTGTAAGGCAACAAATAGCCATGGCCCATCTGATAAACCAACAGATTGCCGTTAGCCGGCTCCTGGCTCACCAGCATCCTCAAGCCATCAACCAGCAGTTCCTGAACCATCCACCCATCCCCAGAGCAGTTAAGCCAGAGCCAAC

N° accesso Ensembl | uomo

ENSG00000119042

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SATB2(23314) , SATB2(23314)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

J-Y Li et al.
European review for medical and pharmacological sciences, 23(15), 6394-6403 (2019-08-06)
We aimed to explore the role of microRNA-449b-5p in osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) and its mechanism of action. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) assay was used to detect the expression levels of microRNA-449b-5p and
Yi-Qing Wang et al.
Cancer research, 79(14), 3542-3556 (2019-03-13)
Accumulating evidence suggests that long noncoding RNA (lncRNA) plays important regulatory roles in cancer biology. However, the involvement of lncRNA in colorectal carcinoma progression remains largely unknown, especially in colorectal carcinoma metastasis. In this study, we investigated the changes in
Jianbing Hao et al.
Cell and tissue research, 366(3), 733-746 (2016-08-10)
Increasing evidence shows that aldosterone and specific microRNAs (miRs) contribute to vascular smooth muscle cell (VSMC) calcification. In this study, we aim to explore the mechanistic links between miR-34b/c and aldosterone in VSMC calcification. VSMC calcification models were established both
Jianfei Tang et al.
Bone, 114, 137-143 (2018-06-18)
Emerging evidence indicates that microRNAs (miRNAs, miRs) play diverse roles in the regulation of biological processes, including osteoblastic differentiation. In this study, we found that miR-383 is a critical regulator of osteoblastic differentiation. We showed that miR-383 was downregulated during

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.