Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU028781

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACACCAAGAGTGGCCCTAAGAACATGACCTTTGACCTGCCATCAGATGCCACAGTGGTGCTCAACCGCAGCTCCTGTGGAAAAGAGAACACTTCTGACCCCAGTCTCGTGATTGCTTTTGGAAGAGGACATACACTCACTCTCAATTTCACGAGAAATGCAACACGTTACAGCGTCCAGCTCATGAGTTTTGTTTATAACTTGTCAGACACACACCTTTTCCCCAATGCGAGCTCCAAAGAAATCAAGACTGTGGAATCTATAACTGACATCAGGGCAGATATAGATAAAAAATACAGATGTGTTAGTGGCACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACCATCCAGGCGTACCTTTCCAACAGCAGCTTCAGCCGGGGAGAGACACGCTGTGAACA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Keren Zhou et al.
Stroke, 49(1), 175-183 (2017-12-24)
The NLRP3 (nucleotide binding and oligomerization domain-like receptor family pyrin domain-containing 3) inflammasome is a crucial component of the inflammatory response in early brain injury after subarachnoid hemorrhage (SAH). In this study, we investigated a role of dihydrolipoic acid (DHLA)
Vikash Singh et al.
The Journal of biological chemistry, 292(5), 1847-1864 (2016-12-10)
Salmonella enterica are invasive intracellular pathogens that replicate within a membrane-bound compartment inside infected host cells known as the Salmonella-containing vacuole. How Salmonella obtains nutrients for growth within this intracellular niche despite the apparent isolation is currently not known. Recent
Masaki Ikeda et al.
BMC microbiology, 15, 263-263 (2015-11-18)
Nontypeable Haemophilus influenzae (NTHi) is one of the most common Gram-negative pathogens in otitis media and exacerbation of chronic obstructive pulmonary disease. NTHi has been reported to invade bronchial epithelial cells. This penetration enables NTHi to evade the host immune
Akhil Kumar Agarwal et al.
Biochemical and biophysical research communications, 449(3), 332-337 (2014-05-23)
Lysosome Associated Membrane Protein-1 (LAMP1), which lines the lysosomes, is often found to be expressed on surface of metastatic cells. We previously demonstrated that its surface expression on B16 melanoma variants correlates with metastatic potential. To establish the role of
Chuan-Ying Xu et al.
Frontiers in aging neuroscience, 9, 308-308 (2017-10-13)
α-Synuclein misfolding and aggregation play an important role in the pathogenesis of Parkinson's disease (PD). Loss of function and mutation of the PARK7/DJ-1 gene cause early-onset familial PD. DJ-1 can inhibit α-synuclein aggregation, and may function at an early step

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.