Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU028021

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAAGAGATCCCCCTGCATTTCAGGAAAGTTGTATGGGGAACTGCTGACATCATGATTGGCTTTGCGCGAGGAGCTCATGGGGACTCCTACCCATTTGATGGGCCAGGAAACACGCTGGCTCATGCCTTTGCGCCTGGGACAGGTCTCGGAGGAGATGCTCACTTCGATGAGGATGAACGCTGGACGGATGGTAGCAGTCTAGGGATTAACTTCCTGTATGCTGCAACTCATGAACTTGGCCATTCTTTGGGTATGGGACATTCCTCTGATCCTAATGCAGTGATGTATCCAACCTATGGAAATGGAGATCCCCAAAATTTTAAACTTTCCCAGGATGATATTAAAGGCATTCAGAAACTATATGGAAAGAGAAGTAATTCAAGAAAGAAATAGAAACTTCAGGCAGAACATCCATTCATTCATTCATTGGATTGTATATCATTGTTGCACAATCAGAATTGATAAGCACTGTTCCTCCACTCCAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ahmad Ghasemi et al.
Journal of cellular biochemistry, 119(2), 2333-2344 (2017-09-09)
Leptin, an adipokine secreted by adipose tissue, induces cell invasion and metastasis. MMP7 is a member of the matrix metalloproteinase family that plays an important role in cell invasion. Here we evaluate the possible role and underlying mechanism of MMP7
Sojoong Choi et al.
Oncotarget, 6(6), 3874-3886 (2015-02-18)
Because earlier studies showed the cell surface heparan sulfate proteoglycan, syndecan-2, sheds from colon cancer cells in culture, the functional roles of shed syndecan-2 were assessed. A non-cleavable mutant of syndecan-2 in which the Asn148-Leu149 residues were replaced with Asn148-Ile149
Q Zhang et al.
Oncogene, 36(5), 687-699 (2016-07-05)
Chronic inflammation has been associated with a variety of human cancers including prostate cancer. Interleukin-17 (IL-17) is a critical pro-inflammatory cytokine, which has been demonstrated to promote development of prostate cancer, colon cancer, skin cancer, breast cancer, lung cancer and
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the

Global Trade Item Number

SKUGTIN
EHU028021-20UG4061828577224
EHU028021-50UG4061831371437

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.