Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU028011

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC2A1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTTCACTGTCGTGTCGCTGTTTGTGGTGGAGCGAGCAGGCCGGCGGACCCTGCACCTCATAGGCCTCGCTGGCATGGCGGGTTGTGCCATACTCATGACCATCGCGCTAGCACTGCTGGAGCAGCTACCCTGGATGTCCTATCTGAGCATCGTGGCCATCTTTGGCTTTGTGGCCTTCTTTGAAGTGGGTCCTGGCCCCATCCCATGGTTCATCGTGGCTGAACTCTTCAGCCAGGGTCCACGTCCAGCTGCCATTGCCGTTGCAGGCTTCTCCAACTGGACCTCAAATTTCATTGTGGGCATGTGCTTCCAGTATGTGGAGCAACTGTGTGGTCCCTACGTCTTCATCATCTTCACTGTGCTCCTGGTTCTGTTCTTCATCTTCACCTACTTCAAAGTTCCTGAGACTAAAGGCCGGACCTTCGATGAGATCGCTTCCGGCTTCCGGCAGGGGGGAGCCAGCCAAAGTGACAAGACACCCGAGG

N° accesso Ensembl | uomo

ENSG00000117394

N° accesso NCBI

NM_006516

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SLC2A1(6513) , SLC2A1(6513)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ZAV
INU
WNS
RAS
EXR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiaohui Wei et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 54, 120-131 (2019-01-23)
Emerging hallmark of cancer is reprogrammed cellular metabolism, increased glycolytic metabolism is physiological characteristic of human malignant neoplasms. Saponin monomer 13 of the dwarf lilyturf tuber (DT-13) is the main steroidal saponin from Liriopes Radix, which has been reported to
Sarka Tumova et al.
Vascular pharmacology, 87, 219-229 (2016-11-09)
Endothelial cells are routinely exposed to elevated glucose concentrations post-prandially in healthy individuals and permanently in patients with metabolic syndrome and diabetes, and so we assessed their sugar transport capabilities in response to high glucose. In human umbilical vein (HUVEC)
Huanyu Zhao et al.
Journal of Cancer, 10(20), 4989-4997 (2019-10-11)
Background: Glucose transporter 1 (GLUT1) is the main factor of Warburg effect, which is associated with poor prognosis in many tumors. However, the underlying molecular mechanism of GLUT1 in the progression of non-small cell lung cancer (NSCLC) is unclear. Methods:
Hongshuo Zhang et al.
Frontiers in physiology, 11, 543148-543148 (2020-10-27)
Successful embryo implantation requires receptive endometrium, which is conducive to the process of embryo recognition, adhesion, and invasion within a certain period of time and is inseparable from the dynamic interaction between 17β-estradiol (E2) and progesterone (P4). Proper glucose metabolism
Zibo Zhao et al.
Science advances, 5(7), eaax0698-eaax0698 (2019-08-09)
The zinc finger of the cerebellum (ZIC) proteins has been implicated to function in normal tissue development. Recent studies have described the critical functions of Zic proteins in cancers and the potential tumor-suppressive functions in colon cancer development and progression.
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.