Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU024671

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTG

N° accesso Ensembl | uomo

ENSG00000135046

N° accesso NCBI

NM_000700

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ANXA1(301) , ANXA1(301)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
TYU
QCS
DOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yin Zhao et al.
Biochimica et biophysica acta, 1863(6), 1350-1358 (2017-04-09)
The degeneration of retinal ganglion cells (RGCs) has been identified as a major problem in glaucoma. Previous studies have indicated an association between annexin A1 (ANXA1) and neuronal cell apoptosis, and RGCs apoptosis in acute ischemia-reperfusion was attributed to an
Hisashi Onozawa et al.
Oncology reports, 37(1), 235-240 (2016-11-15)
Resistance to 5-fluorouracil (5‑FU), a key drug in the treatment of colorectal cancer, is one of the major reasons for poor patient prognosis during cancer treatment. Annexin A1 (ANXA1) is a calcium‑dependent phospholipid‑linked protein that is associated with drug resistance, anti‑inflammatory effects
Chandrika Senthilkumaran et al.
Veterinary research, 46, 6-6 (2015-04-02)
Annexins A1 and A2 are proteins known to function in the stress response, dampening inflammatory responses and mediating fibrinolysis. We found, in healthy cattle recently arrived to a feedlot, that lower levels of these proteins correlated with later development of
Anjana Bhardwaj et al.
PloS one, 10(5), e0127678-e0127678 (2015-05-23)
Annexin A1 (ANXA1) is an anti-inflammatory protein reported to play a role in cell proliferation and apoptosis, and to be deregulated in breast cancer. The exact role of annexin A1 in the biology of breast cancer remains unclear. We hypothesized

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.