Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU022031

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT6

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGCCAAAGCCACTATCCTGTGGGACAATGCCTTCTCTGAGATGGACCGCGTGCCCTTTGTGGTGGCTGAGCGGGTGCCCTGGGAGAAGATGTGTGAAACTCTGAACCTGAAGTTCATGGCTGAGGTGGGGACCAACCGGGGGCTGCTCCCAGAGCACTTCCTCTTCCTGGCCCAGAAGATCTTCAATGACAACAGCCTCAGTATGGAGGCCTTCCAGCACCGTTCTGTGTCCTGGTCGCAGTTCAACAAGGAGATCCTGCTGGGCCGTGGCTTCACCTTTTGGCAGTGGTTTGATGGTGTCCTGGACCTCACCAAACGCTGTCTCCGGAGCTACTGGTCTGACCGGCTGATCATTGGCTTCATCAGCAAACAGTACGTTACTAGCCTTCTTCTCAATGAGCCCGACGGAACCTTTCTCCTCCGCTTCAGCGACTCAGAGATTGGGGGCATCACCATTGCCCATGTCATCCGGGGCCAGGATGGCTCTCCACAGAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Tian Qing et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 1-6 (2017-05-20)
Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC)
Zachary P McKay et al.
Journal of immunology (Baltimore, Md. : 1950), 206(6), 1385-1394 (2021-01-29)
Crosstalk between costimulatory and coinhibitory ligands are a prominent node of immune cell regulation. Mounting evidence points toward a critical role for CD155, the poliovirus receptor, in suppressing T cell function, particularly in cancer. However, relative to other known costimulatory/coinhibitory
Li Yang et al.
Cellular & molecular immunology, 13(5), 669-677 (2015-07-21)
The etiology and the underlying mechanism of CD4(+) T-cell polarization are unclear. This study sought to investigate the mechanism by which interleukin (IL)-13 prevents the activation-induced apoptosis of CD4(+) T cells. Here we report that CD4(+) T cells expressed IL-13
Kristine C Olson et al.
Cytokine, 111, 551-562 (2018-11-21)
Calcitriol, the active form of vitamin D, has been well documented to act directly on immune cells and malignant cells. Activated T cells are one of the best characterized targets of calcitriol, with effects including decreasing inflammatory cytokine output and
Noelia Keiran et al.
Nature immunology, 20(5), 581-592 (2019-04-10)
Succinate is a signaling metabolite sensed extracellularly by succinate receptor 1 (SUNCR1). The accumulation of succinate in macrophages is known to activate a pro-inflammatory program; however, the contribution of SUCNR1 to macrophage phenotype and function has remained unclear. Here we

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.