Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU020491

Sigma-Aldrich

MISSION® esiRNA

targeting human CFTR

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTTGGG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Luiz Felipe M Prota et al.
PloS one, 7(12), e47405-e47405 (2012-12-29)
Dexamethasone is widely used for pulmonary exacerbation in patients with cystic fibrosis, however, not much is known about the effects of glucocorticoids on the wild-type cystic fibrosis channel transmembrane regulator (CFTR). Our aim was to determine the effects of dexamethasone
Maria Favia et al.
Molecular biology of the cell, 21(1), 73-86 (2009-11-06)
We have demonstrated that Na(+)/H(+) exchanger regulatory factor 1 (NHERF1) overexpression in CFBE41o- cells induces a significant redistribution of F508del cystic fibrosis transmembrane conductance regulator (CFTR) from the cytoplasm to the apical membrane and rescues CFTR-dependent chloride secretion. Here, we
Pascale Marcorelles et al.
The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society, 62(11), 791-801 (2014-07-27)
Cystic Fibrosis Transmembrane conductance Regulator (CFTR) protein has recently been shown to be expressed in the human adult central nervous system (CNS). As CFTR expression has also been documented during embryonic development in several organs, such as the respiratory tract
Babita Kaundal et al.
Journal of materials chemistry. B, 8(37), 8658-8670 (2020-08-28)
Acute myeloid leukemia (AML), which is common in the elderly population, accounts for poor long-term survival with a high possibility of relapse. The associated lack of currently developed therapeutics is directing the search for new therapeutic targets relating to AML.
C Norez et al.
British journal of pharmacology, 171(21), 4831-4849 (2014-07-30)
The most common mutation in cystic fibrosis (CF), F508del, causes defects in trafficking, channel gating and endocytosis of the CF transmembrane conductance regulator (CFTR) protein. Because CF is an orphan disease, therapeutic strategies aimed at improving mutant CFTR functions are

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.