Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

Altri documenti

EHU020331

Sigma-Aldrich

MISSION® esiRNA

targeting human IRS1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACCCCAATGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTGGAGGTGGCCCCAGCAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAGCTATGGAAAGCTGTGGACAAACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCTCACCCCAAACCCCCAGTGGAGAGCAGCGGTGGTAAGCTCTTACCTTGCACAGGTGACTACATGAACATGTCACCAGTGGGGGACTCCAACACCAGCAGCCCCTCCGACTGCTACTACGGCCCTGAGGACCCCCAGCACAAGCCAGTCCTCTCCTACTACTCATTGCCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCGGAGGAGGGTGCCCGGCATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTC

N° accesso Ensembl | uomo

ENSG00000169047

N° accesso NCBI

NM_005544

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IRS1(3667) , IRS1(3667)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yongxin Luan et al.
International journal of clinical and experimental pathology, 8(9), 10345-10354 (2015-12-01)
MicroRNA (miR-126) was reported to be downregulated and to act as a tumor suppressor in cancers of the lung, cervix, bladder, breast, liver and prostate. However, the precise roles and underling mechanisms of miR-126 in glioma remain largely unknown. This
Y Chen et al.
European review for medical and pharmacological sciences, 23(18), 7989-7999 (2019-10-11)
The important role of microRNA-1271 (miR-1271) has been identified in human diseases and cancers. However, the biological function of miR-1271 remains ambiguous in papillary thyroid carcinoma (PTC). Therefore, the specific role of miR-1271 was investigated in PTC. The expressions of
Peng Wang et al.
Technology in cancer research & treatment, 16(6), 1102-1112 (2018-01-16)
Thyroid cancer is a common endocrine gland malignancy which exhibited rapid increased incidence worldwide in recent decades. This study was aimed to investigate the role of long noncoding RNA H19 in thyroid cancer. Long noncoding RNA H19 was overexpressed or
Qianyi Luo et al.
Investigative ophthalmology & visual science, 60(6), 1928-1936 (2019-05-03)
Diabetes leads to the downregulation of the retinal Kir4.1 channels and Müller cell dysfunction. The insulin receptor substrate-1 (IRS-1) is a critical regulator of insulin signaling in Müller cells. Circadian rhythms play an integral role in normal physiology; however, diabetes
Piero Dalle Pezze et al.
Nature communications, 7, 13254-13254 (2016-11-22)
Amino acids (aa) are not only building blocks for proteins, but also signalling molecules, with the mammalian target of rapamycin complex 1 (mTORC1) acting as a key mediator. However, little is known about whether aa, independently of mTORC1, activate other
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.