Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

View All Documentation

EHU019041

Sigma-Aldrich

MISSION® esiRNA

targeting human STK11

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAAGAGAAGCAGAAAATATATCCTTTCCGCCCTTACTGCGTGTGTGGCATGCAGGAAATGCTGGACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTGATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGGAACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCACTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAGCCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCGGCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATCTACAAGTTGTTTGAGAACATCGGGAAGG

N° accesso Ensembl | uomo

ENSG00000118046

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... STK11(6794) , STK11(6794)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Qing Ma et al.
Oncology letters, 16(1), 1291-1297 (2018-07-03)
Liver kinase B1 (LKB1) encodes a serine/threonine kinase and functions as a tumor suppressor. LKB1 loss-of-function somatic mutations are frequently observed in sporadic types of cancer, particularly in lung cancer. Ectopic LKB1 induces growth arrest by upregulating p21/cyclin dependent kinase
Taiyuan Li et al.
Biochemical and biophysical research communications, 482(4), 1037-1041 (2016-12-03)
Partitioning defective 3-like protein (Par3L) is a recently identified cell polarity protein that plays an important role in mammary stem cell maintenance. Previously, we showed that high expression of Par3L is associated with poor survival in malignant colorectal cancer (CRC)
Youn Ju Lee et al.
PloS one, 14(1), e0211415-e0211415 (2019-01-30)
Alcoholic liver disease (ALD) is a worldwide health problem and hepatocyte apoptosis has been associated with the development/progression of ALD. However, no definite effective pharmacotherapy for ALD is currently available. Cilostazol, a selective type III phosphodiesterase inhibitor has been shown
Shalini V Rao et al.
BMC cancer, 17(1), 68-68 (2017-01-23)
The peptide hormone gastrin exerts a growth-promoting effect in both normal and malignant gastrointestinal tissue. Gastrin mediates its effect via the cholecystokinin 2 receptor (CCKBR/CCK2R). Although a substantial part of the gastric adenocarcinomas express gastrin and CCKBR, the role of
Jacob M Kaufman et al.
Cancer research, 77(1), 153-163 (2016-11-09)
LKB1 is a commonly mutated tumor suppressor in non-small cell lung cancer that exerts complex effects on signal transduction and transcriptional regulation. To better understand the downstream impact of loss of functional LKB1, we developed a transcriptional fingerprint assay representing
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.