Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU017981

Sigma-Aldrich

MISSION® esiRNA

targeting human GPNMB

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACTGCAGAAATGAGGCTGGTTTATCTGCTGATCCGTATGTTTACAACTGGACAGCATGGTCAGAGGACAGTGACGGGGAAAATGGCACCGGCCAAAGCCATCATAACGTCTTCCCTGATGGGAAACCTTTTCCTCACCACCCCGGATGGAGAAGATGGAATTTCATCTACGTCTTCCACACACTTGGTCAGTATTTCCAGAAATTGGGACGATGTTCAGTGAGAGTTTCTGTGAACACAGCCAATGTGACACTTGGGCCTCAACTCATGGAAGTGACTGTCTACAGAAGACATGGACGGGCATATGTTCCCATCGCACAAGTGAAAGATGTGTACGTGGTAACAGATCAGATTCCTGTGTTTGTGACTATGTTCCAGAAGAACGATCGAAATTCATCCGACGAAACCTTCCTCAAAGATCTCCCC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Rui Jin et al.
Oncology reports, 39(6), 3034-3040 (2018-04-06)
Glycoprotein non‑metastatic melanoma protein B (GPNMB) is a glycoprotein that is highly expressed in various types of cancer, including osteosarcoma. However, its cellular functions and related mechanisms in osteosarcoma remain unclear. In the present study, a higher GPNMB mRNA level was
Feifei Ren et al.
Journal of cellular physiology, 235(3), 2738-2752 (2019-09-10)
Gastric cancer has the fifth highest incidence of disease and is the third leading cause of cancer-associated mortality in the world. The etiology of gastric cancer is complex and needs to be fully elucidated. Thus, it is necessary to explore
Basilio Smuczek et al.
Experimental cell research, 358(2), 323-334 (2017-07-10)
Breast cancer is an important public health problem, and its progression may be related to the extracellular matrix (ECM), which acts as a structural scaffold and instruction source for neoplastic cells. Laminins are ECM proteins regulating tumor biology. The laminin-derived
Kotaro Kumagai et al.
PloS one, 10(11), e0143413-e0143413 (2015-11-26)
Glycoprotein nonmetastatic melanoma B (Gpnmb), a transmembrane glycoprotein that is expressed in macrophages, negatively regulates inflammation. We have reported that Gpnmb is strongly expressed in the livers of rats fed a choline-deficient, L-amino acid-defined (CDAA) diet. However, the role of
Yu-Liang Wang et al.
International journal of clinical and experimental pathology, 8(6), 6498-6504 (2015-08-12)
Glycoprotein (transmembrane) nonmetastatic melanoma protein b (GPNMB) plays crucial roles in odontogenesis. However, the role of GPNMB in human dental pulp cells (hDPCs) is still unclear. Therefore, in this study, we investigated the expression and function of the GPNMB in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.