Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU009821

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TAGCCACAGTGACAGGCAACCTGCTGGTACTCATCTCTTTCAAGGTCAACACGGAGCTCAAGACAGTCAATAACTACTTCCTGCTGAGCCTGGCCTGTGCTGACCTCATCATCGGTACCTTCTCCATGAACCTCTATACCACGTACCTGCTCATGGGCCACTGGGCTCTGGGCACGCTGGCTTGTGACCTCTGGCTGGCCCTGGACTATGTGGCCAGCAATGCCTCCGTCATGAATCTGCTGCTCATCAGCTTTGACCGCTACTTCTCCGTGACTCGGCCCCTGAGCTACCGTGCCAAGCGCACACCCCGCCGGGCAGCTCTGATGATCGGCCTGGCCTGGCTGGTTTCCTTTGTGCTCTGGGCCCCAGCCATCCTCTTCTGGCAGTACCTGGTAGGGGAGCGGACAGTGCTAGCTGGGCAGTGCTACATCCAGTTCCTCTCCCAGCCCATCATCACCTTTGGCACAGCCATGGCTGCCTTCTACCTCCCTGTCACAGTCATGTGCACGCTCTACTGGCGCATCTACC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Deyu Zeng et al.
Journal of cellular biochemistry, 119(2), 1855-1865 (2017-08-13)
Pancreatic cancer is one of the major human malignant tumors severely endangering human health and life with high mortality due to the concealment of early symptoms and lack of effective therapies during advanced stages. The identification of pancreatic cancer stem
Jingjing Zhang et al.
Gynecologic and obstetric investigation, 84(5), 485-494 (2019-05-01)
The aim of this study was to investigate the expression of Forkhead box M1 (FoxM1) in endometriosis and determine FoxM1's possible effects on endometriotic epithelial cells (EECs) invasion and epithelial-mesenchymal transition (EMT). The expression of FoxM1 and E-cadherin in endometrium
Xinping Yang et al.
American journal of translational research, 10(2), 629-638 (2018-03-08)
The FoxM1 (Forkhead Box M1) transcription factor plays a key role in regulation of cell growth, cell cycle, and transformation. Higher expression of FoxM1 has been observed in various types of human cancers including bladder cancer. However, the exact function
Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
Tao Wang et al.
Molecular and cellular biochemistry, 413(1-2), 179-187 (2016-01-29)
The prolyl isomerase Pin1, which is frequently highly expressed in many different cancers, can directly regulate cell proliferation and the cell cycle. However, the role of Pin1 in chemo-resistance remains to be elucidated in cervical cancer. The purpose of the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.