Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU002651

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP1LC3B

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCAAGTGAGCACATTCAGCTTTGGAAACTATATTATTTAATGTAGGCTAGCTTGTTTTCAAATTTTAAAAGTTTAAAAATAAAATACTTTGCATTCTAAGTTGCCAATAAAATAGACCTTCAAGTTATTTTAATGCTCTTTTCTCACTAATAGGAACTTGTAATTCCAGCAGTAATTTAAAGGCTTTCAGAGAGACCCTGAGTCTTCTCTTCAGGTTCACAAAACCCGCCGCCTTTTTGGGTAGAAGTTTTCTACTCAGCTAGAGAGATCTCCCTAAGAGGATCTTTAGGCCTGAGTTGTGAAGCGCAACCCCCGCAAAACGCATTTGCCATCACAGTTGGCACAAACGCAGGGTAAACGGGCTGTGTGAGAAAACGGCCCTGACTGTAAACTGCTGAAGGTCCCTGACTCCTAAGAGAACCACACCCAAAGTCCTCACT

N° accesso Ensembl | uomo

ENSG00000140941

N° accesso NCBI

NM_022818

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MAP1LC3B(81631) , MAP1LC3B(81631)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
PSU
QCS
DLT
EGS
SGT

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Tamotsu Tsukahara et al.
BioMed research international, 2013, 204973-204973 (2013-11-30)
Our previous study demonstrated that PTB-associated splicing factor (PSF) is an important regulator of cell death and plays critical roles in the survival and growth of colon cancer cells. However, the molecular mechanism that activates these downstream signaling events remains
Alok Ranjan et al.
Scientific reports, 6, 26165-26165 (2016-05-18)
Pancreatic tumors exhibit enhanced autophagy as compared to any other cancer, making it resistant to chemotherapy. We evaluated the effect of penfluridol against pancreatic cancer. Penfluridol treatment induced apoptosis and inhibited the growth of Panc-1, BxPC-3 and AsPC-1, pancreatic cancer
Sheeja Aravindan et al.
Journal of biomedical science, 22, 28-28 (2015-04-22)
Identifying the drug-deliverables that target autophagy is crucial to finding a cure for pancreatic cancer (PC), as activated autophagy is associated with poor patient outcomes. Our recent studies recognized the anti-PC potential of an antioxidant-rich collection of seaweed polyphenols and
S Kumar et al.
Cell death & disease, 4, e889-e889 (2013-11-02)
Angiogenesis has a key role in the tumor progression and metastasis; targeting endothelial cell proliferation has emerged as a promising therapeutic strategy for the prevention of cancer. Previous studies have revealed a complex association between the process of angiogenesis and
Saroj Nepal et al.
Biomolecules & therapeutics, 22(5), 384-389 (2014-11-22)
Adiponectin, an adipokine predominantly secreted from adipose tissue, exhibits diverse biological responses, including metabolism of glucose and lipid, and apoptosis in cancer cells. Recently, adiponectin has been shown to modulate autophagy as well. While emerging evidence has demonstrated that autophagy
Visualizza tutti i documenti correlati

Global Trade Item Number

SKUGTIN
EHU002651-20UG4061831360226
EHU002651-50UG4061828443468

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.