Skip to Content
Merck
All Photos(1)

Key Documents

EMU187301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ldha

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCAAAAGATTCAAAGTCCAAGATGGCAACCCTCAAGGACCAGCTGATTGTGAATCTTCTTAAGGAAGAGCAGGCTCCCCAGAACAAGATTACAGTTGTTGGGGTTGGTGCTGTTGGCATGGCTTGTGCCATCAGTATCTTAATGAAGGACTTGGCGGATGAGCTTGCCCTTGTTGACGTCATGGAAGACAAACTCAAGGGCGAGATGATGGATCTCCAGCATGGCAGCCTCTTCCTTAAAACACCAAAAATTGTCTCCAGCAAAGACTACTGTGTAACTGCGAACTCCAAGCTGGTCATTATCACCGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guojun Hua et al.
Oncology reports, 31(6), 2727-2734 (2014-05-03)
Chondrosarcoma is a malignant cartilage-forming cancer composed of cells derived from transformed cells that produce cartilage. Conventional chemotherapy and radiotherapy have very limited efficacy in patients with advanced chondrosarcoma. In the present study, we reported a novel therapeutic approach in
Wenyi Sun et al.
PloS one, 10(5), e0125976-e0125976 (2015-05-15)
Oral squamous cell carcinoma (OSCC) comprises a subset of head and neck squamous cell carcinoma (HNSCC) with poor therapeutic outcomes and high glycolytic dependency. Neoadjuvant chemotherapy regimens of docetaxel, cisplatin and 5-fluorouracil (TPF) are currently accepted as standard regimens for
Balkrishna Chaube et al.
Oncotarget, 6(35), 37281-37299 (2015-10-21)
Melanoma is a largely incurable skin malignancy owing to the underlying molecular and metabolic heterogeneity confounded by the development of resistance. Cancer cells have metabolic flexibility in choosing either oxidative phosphorylation (OXPHOS) or glycolysis for ATP generation depending upon the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service