Skip to Content
Merck
All Photos(1)

Key Documents

EMU078951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp9x

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCGAGCTATTGATCTCCTTAAAGAGATATACACAAACCTTGGTCCAAGGCTGCAGGTCAATCAGGTGGTGATCCATGAAGACTTCATTCAGTCTTGCTTTGATCGTTTGAAAGCCTCTTATGACACATTGTGTGTTTTGGATGGTGACAAAGACAGTATTAATTGTGCAAGACAGGAAGCTGTTCGAATGGTCCGAGTGTTAACTGTTCTAAGAGAATATATAAATGAATGTGACAGTGATTATCATGAAGAAAGAACAATTTTGCCTATGTCAAGAGCTTTCCGTGGTAAACACCTCTCTTTTATAGTTCGATTTCCAAACCAGGGCAGGCAAGTAGATGACTTGGAGGTTTGGTCTCATACAAATGATACCATTGGTTCAGTTCGAAGATGTATACTCAATCGTATTAAAGCCAATGTAGCTCATACAAAAATTGAACTCTTTGTGGGTGGTGAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jesse L Cox et al.
Cancer biology & therapy, 15(8), 1042-1052 (2014-05-21)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and deadly malignancies. Recently, the deubiquitinating protease USP9X has been shown to behave as an oncogene in a number of neoplasms, including those of breast, brain, colon, esophagus and lung
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Deepa Kushwaha et al.
Cancer biology & therapy, 16(3), 392-401 (2015-02-19)
Radiotherapy (RT) is vital for the treatment of locally advanced non-small cell lung cancer (NSCLC), yet its delivery is limited by tolerances of adjacent organs. We sought therefore to identify and characterize gene targets whose inhibition may improve RT. Whole

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service