Skip to Content
Merck
All Photos(1)

Key Documents

EHU124671

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR3 (2)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACGACTCCGTGTTTGCCCACGACCTGCTGGCCACTGGTCCCCAACAATGTGAGGGGTCCCTAGCAGCCCACCCTGCTGCTGGTGCACAGCCACTCCCCGGCATGAGACTCAGTGCAGATGGAGAGACAGCTACACAGAGCTTTGGTCTGTGTGTGTGTGTGTGCTGTGTGTGTGTGTGCACATCCGCGTGTGCCTGTGTGCGTGCGCATCTTGCCTCCAGGTGCAGAGGTACCCTGGGTGTCCCCGCTGCTGTGCAACGGTCTCCTGACTGGTGCTGCAGCACCGAGGGGCCTTTGTTCTGGGGGGACCCAGTGCAGAATGTAAGTGGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FGFR3(2261)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

V Tassinari et al.
Cell death & disease, 6, e1688-e1688 (2015-03-15)
Both fibroblast growth factor 9 (Fgf9) and Kit Ligand (Kl) signal through tyrosine kinase receptors, yet they exert opposite effects on meiotic differentiation in postnatal spermatogonia, Fgf9 acting as a meiosis-inhibiting substance and Kl acting as a promoter of the
Jing Yang et al.
Cell cycle (Georgetown, Tex.), 14(20), 3318-3330 (2015-09-18)
Fibroblast growth factors (FGF1, FGF2 and FGF4) and fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3 and FGFR4) have been reported to be expressed in preimplantation embryos and be required for their development. However, the functions of these molecules in trophectoderm
Xiufeng Jiang et al.
Oncotarget, 6(14), 12340-12356 (2015-04-22)
Sorafenib, an oral multikinase inhibitor of Raf, VEGF and PDGF receptor signaling is approved for advanced hepatocellular carcinoma (HCC). One strategy to improve HCC therapy is to combine agents that target key signaling pathways. Aberrant mesenchymal-epithelial transition factor (c-Met) activation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service