Skip to Content
Merck
All Photos(1)

Key Documents

EHU094321

Sigma-Aldrich

MISSION® esiRNA

targeting human WNK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCACTTCATTCCCAAGCACAGCTTCACAGCTGTGCATTCAGCTTAGCAGCAGTACTTCTACTCCTACTTTAGCTGAAACCGTGGTAGTTAGCGCACACTCACTAGATAAGACATCTCATAGCAGTACAACTGGATTGGCTTTCTCCCTCTCTGCACCATCTTCCTCTTCCTCTCCTGGAGCAGGAGTGTCTAGTTATATTTCTCAGCCTGGTGGGCTGCATCCTTTGGTCATTCCATCAGTGATAGCTTCTACTCCTATTCTTCCCCAAGCAGCAGGACCTACTTCTACACCTTTATTACCCCAAGTACCTAGTATCCCACCCTTGGTACAGCCTGTTGCCAATGTGCCTGCTGTACAGCAGACACTAATTCATAGTCAGCCTCAACCAGCTTTGCTTCCCAACCAGCCCCATACTCATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sukanya Shyamasundar et al.
International journal of oncology, 49(6), 2629-2636 (2016-11-15)
Despite advances in treatment, the highly metastatic nature of breast tumors has given rise to the urgent need for development of novel therapeutic and prognostic markers. miR-93 is known to regulate the epithelial to mesenchymal transition process and to influence
Hui Dong et al.
Journal of cellular physiology, 235(10), 6548-6562 (2020-02-19)
Long noncoding RNAs (lncRNAs) have been recognized as cancer-associated biological molecules, favoring hepatocellular carcinoma (HCC) progression. This study was conducted to elucidate the effects lncRNA lymphoid enhancer-binding Factor 1 antisense RNA (LEF1-AS1) on the pathological development of HCC, along with
Jen-Yu Hung et al.
Oncotarget, 8(38), 63691-63702 (2017-10-04)
The extracellular matrix is a component of physiological microenvironment and a regulator of cellular processes such as migration and proliferation. Secreted Protein Acidic and Rich in Cysteine (SPARC/osteonectin) is an extracellular matrix-associated glycoprotein involved in the regulation of cell proliferation
Jian-Ling Gao et al.
The journal of pain : official journal of the American Pain Society, 20(12), 1416-1428 (2019-05-16)
Our preliminary experiment indicated the activation of with-nolysine kinases 1 (WNK1) in bone cancer pain (BCP) rats. This study aimed to investigate the underlying mechanisms via which WNK1 contributed to BCP. A rat model of BCP was induced by Walker-256
Perrine Friedel et al.
Science signaling, 8(383), ra65-ra65 (2015-07-02)
Activation of Cl(-)-permeable γ-aminobutyric acid type A (GABAA) receptors elicits synaptic inhibition in mature neurons but excitation in immature neurons. This developmental "switch" in the GABA function depends on a postnatal decrease in intraneuronal Cl(-) concentration mediated by KCC2, a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service