Skip to Content
Merck
All Photos(2)

Key Documents

EHU031251

Sigma-Aldrich

MISSION® esiRNA

targeting human CAV1

Sign Into View Organizational & Contract Pricing
All Photos(2)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATC

Ensembl | human accession no.

ENSG00000105974

NCBI accession no.

NM_001753

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CAV1(857) , CAV1(857)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Natalia I Díaz-Valdivia et al.
Oncotarget, 8(67), 111943-111965 (2018-01-18)
Expression of the scaffolding protein Caveolin-1 (CAV1) enhances migration and invasion of metastatic cancer cells. Yet, CAV1 also functions as a tumor suppressor in early stages of cancer, where expression is suppressed by epigenetic mechanisms. Thus, we sought to identify
Sang Woong Park et al.
Pflugers Archiv : European journal of physiology, 469(5-6), 829-842 (2017-03-18)
Activation of L-type voltage-dependent Ca
Magdiel Martínez et al.
Biomolecules, 9(10) (2019-10-23)
Caveolae-associated protein caveolin-1 (Cav-1) plays key roles in cellular processes such as mechanosensing, receptor coupling to signaling pathways, cell growth, apoptosis, and cancer. In 1321N1 astrocytoma cells Cav-1 interacts with the P2Y2 receptor (P2Y2R) to modulate its downstream signaling. P2Y2R
Xing Wan et al.
Clinical and translational medicine, 9(1), 3-3 (2020-01-15)
The incidence and mortality rates of gastric cancer (GC) rank in top five among all malignant tumors. Chemokines and their receptor-signaling pathways reportedly play key roles in the metastasis of malignant tumor cells. Receptor activator of nuclear factor κB ligand
Byung-Kyu Ryu et al.
BMC cancer, 17(1), 766-766 (2017-11-17)
Expression of caveolin-1 (Cav-1) is frequently altered in many human cancers and both tumor suppression and promotion functions of Cav-1 have been suggested based on its expression status. However, it remains unanswered how Cav-1 provokes opposite effects in different cancers
View All Related Papers

Articles

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service