Skip to Content
Merck
All Photos(1)

Key Documents

EHU025291

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A3R1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTCACCAATGGGGAGATACAGAAGGAGAACAGTCGTGAAGCCCTGGCAGAGGCAGCCTTGGAGAGCCCCAGGCCAGCCCTGGTGAGATCCGCCTCCAGTGACACCAGCGAGGAGCTGAATTCCCAAGACAGCCCCCCAAAACAGGACTCCACAGCGCCCTCGTCTACCTCCTCCTCCGACCCCATCCTAGACTTCAACATCTCCCTGGCCATGGCCAAAGAGAGGGCCCACCAGAAACGCAGCAGCAAACGGGCCCCGCAGATGGACTGGAGCAAGAAAAACGAACTCTTCAGCAACCTCTGAGCGCCCTGCTGCCACCCAGTGACTGGCAGGGCCGAGCCAGCATTCCACCCCACCTTTTTCCTTCTCCCCAATTACTCCCCTGAATCAATGTACAAATCAGCACCCACATCCCCTTTCTTGACAAATGATTTTTCTAGAGAACTATGTTCTTCCCTGACTTTAGGGAAGGTGAATGTGTTCCCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Darren K Patten et al.
Nature medicine, 24(9), 1469-1480 (2018-07-25)
The degree of intrinsic and interpatient phenotypic heterogeneity and its role in tumor evolution is poorly understood. Phenotypic drifts can be transmitted via inheritable transcriptional programs. Cell-type specific transcription is maintained through the activation of epigenetically defined regulatory regions including
Rosa Rubino et al.
Pflugers Archiv : European journal of physiology, 466(12), 2269-2278 (2014-03-07)
Pseudomonas aeruginosa infections of the airway cells decrease apical expression of both wild-type (wt) and F508del CFTR through the inhibition of apical endocytic recycling. CFTR endocytic recycling is known to be regulated by its interaction with PDZ domain containing proteins.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service