Skip to Content
Merck
All Photos(1)

Key Documents

EHU017831

Sigma-Aldrich

MISSION® esiRNA

targeting human SOS1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCCACAGTTGAGTGGCATATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACACCCAATAGAAATTGCTCGACAACTCACTTTACTTGAATCAGATCTATACCGAGCTGTACAGCCATCAGAATTAGTTGGAAGTGTGTGGACAAAAGAAGACAAAGAAATTAACTCTCCTAATCTTCTGAAAATGATTCGACATACCACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTAGAAACTGAAAATTTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAAGTCTTTCAAGAGTTGAACAACTTTAATGGTGTCCTTGAGGTTGTCAGTGCTATGAATTCATCACCTGTTTACAGACTAGACCACACATTTGAGCAAATACCAAGTCGCCAGAAGAAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Manish Mishra et al.
Antioxidants & redox signaling, 30(13), 1621-1634 (2018-08-15)
Diabetes increases oxidative stress in the retina and dysfunctions their mitochondria, accelerating capillary cell apoptosis. A 66 kDa adaptor protein, p66Shc, is considered as a sensor of oxidative stress-induced apoptosis. In the pathogenesis of diabetic retinopathy, a progressive disease, reactive oxygen
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service