Skip to Content
Merck
All Photos(1)

Key Documents

EMU043441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hspa2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAGACGCAGACCTTCACTACCTACTCAGACAACCAGAGCAGCGTGCTGGTGCAAGTGTACGAGGGCGAACGGGCCATGACCAAGGACAATAACCTCTTGGGCAAGTTCGACCTGACTGGGATCCCCCCAGCACCCCGTGGGGTCCCCCAGATCGAGGTCACCTTTGACATCGATGCCAACGGCATCCTTAACGTCACTGCTGCCGACAAGAGCACCGGTAAAGAAAATAAAATCACCATAACCAACGACAAGGGTCGGCTGAGCAAAGACGACATTGACCGGATGGTGCAGGAGGCGGAGCGGTACAAATCGGAAGATGAAGCAAATCGCGATCGCGTGGCAGCCAAAAATGCGGTGGAGTCCTATACCTACAACATCAAGCAGACCGTGGAAGACGAGAAACTGAGGGGCAAGATTAGCGAGCAGGACAAAAACAAGATCCTCGACAAGTGTCAGGAGGTGATCAACTGGCTTGACCGAAACCAGATGGCAGAGAAAGATGAGTACGAACACAAGCAGAAAGAGCTTGAGAGAGTGTGCAACCCCAT

Ensembl | mouse accession no.

ENSMUSG00000059970

NCBI accession no.

NP_032327

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... HSPA2(15512) , Hspa2(15512)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dmitry Kondrikov et al.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Kanika Jain et al.
Cell stress & chaperones, 19(6), 801-812 (2014-03-05)
The fall in ambient oxygen pressure in high-altitude milieu elicits a wide range of physiological responses in the myocardium, which may differ from individual to individual. This condition, known as hypobaric hypoxia, invokes the cardioprotective heat shock response. The present
Sujatha Muralidharan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service