Skip to Content
Merck
All Photos(1)

Key Documents

EHU088371

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP1LC3A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGCTACAAGGGTGAGAAGCAGCTGCCCGTCCTGGACAAGACCAAGTTTTTGGTCCCGGACCATGTCAACATGAGCGAGTTGGTCAAGATCATCCGGCGCCGCCTGCAGCTGAACCCCACGCAGGCCTTCTTCCTGCTGGTGAACCAGCACAGCATGGTGAGTGTGTCCACGCCCATCGCGGACATCTACGAGCAGGAGAAAGACGAGGACGGCTTCCTCTATATGGTCTACGCCTCCCAGGAAACCTTCGGCTTCTGAGCCAGCAGTAGGGGGGCTCGGCCTGGGAGTCGGGCGGCCCCGGTCAGGCCCTGCCCAGAGAGCTCCTGGTTCCTGAACTGAGCTGCCTCTACCGTGGTGGGCTGGGCAGGCATGTGCCCCCCTAGTCAGAGGGCACCAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Min Jung Lee et al.
Metabolism: clinical and experimental, 64(9), 1134-1145 (2015-06-09)
Autophagy has emerged as a potentially important factor in the pathogenesis of atherosclerosis. Dehydroepiandrosterone (DHEA) is an adrenal steroid of great recent interest due to its anti-aging and anti-atherogenic effects; however, little is known about its role in autophagy and
Lingxia Li et al.
International journal of molecular medicine, 36(1), 316-322 (2015-05-29)
Pulmonary arterial hypertension (PAH) is a progressive pulmonary vascular disorder with high morbidity and mortality, and is characterized by excessive growth of endothelial cells. Recently, the mammalian target of rapamycin (mTOR) has attracted increasing attention due to its potential as

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service