Skip to Content
Merck
All Photos(2)

Key Documents

EHU083501

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT1, RP11-982M15.2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gang Shen et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 798-809 (2018-10-12)
Bromodomain-containing protein 4 (BRD4) overexpression participates in prostate cancer progression by enhancing the transcriptional activity and expression of several key oncogenes. AZD5153 is a novel BRD4 inhibitor. Prostate cancer cells were treated with AZD5153. Cell survival was tested by MTT
Sisi Chen et al.
Experimental hematology, 45, 74-84 (2016-10-25)
Although practiced clinically for more than 40 years, the use of hematopoietic stem cell (HSC) transplantation remains limited by the inability to expand functional HSCs ex vivo. To determine the role of phosphoinositide 3-kinase (PI3K)/AKT signaling in human hematopoietic stem and progenitor
Guoxing Xu et al.
Scientific reports, 7, 42411-42411 (2017-02-17)
Recent studies have shown that some members of the tripartite motif-containing protein (TRIM) family serve as important regulators of tumorigenesis. However, the biological role of TRIM14 in osteosarcoma remains to be established. In this study, we showed that TRIM14 is
Farrukh Aqil et al.
Cancer letters, 449, 186-195 (2019-02-17)
Gene-silencing with targeted siRNAs has great potential as a therapeutic approach for various diseases including cancer. However, intracellular delivery of siRNA is challenging. We used bovine milk exosomes as a novel system for siRNA delivery. First, we demonstrated that exosomes
Alexander Kretschmer et al.
Scientific reports, 9(1), 7826-7826 (2019-05-28)
Tunneling nanotubes (TNTs) are actin-based membranous structures bridging distant cells for intercellular communication. We define roles for TNTs in stress adaptation and treatment resistance in prostate cancer (PCa). Androgen receptor (AR) blockade and metabolic stress induce TNTs, but not in

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service