Skip to Content
Merck
All Photos(1)

Key Documents

EHU080371

Sigma-Aldrich

MISSION® esiRNA

targeting human STEAP4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGCCTCTCCCTCAGTTATGGAGAAAACTTGTATAGATGCACTTCCTCTTACTATGAATTCTTCAGAAAAGCAAGAGACTGTATGTATTTTTGGAACTGGTGATTTTGGAAGATCACTGGGATTGAAAATGCTCCAGTGTGGTTATTCTGTTGTTTTTGGAAGTCGAAACCCCCAGAAGACCACCCTACTGCCCAGTGGTGCAGAAGTCTTGAGCTATTCAGAAGCAGCCAAGAAGTCTGGCATCATAATCATAGCAATCCACAGAGAGCATTATGATTTTCTCACAGAATTAACTGAGGTTCTCAATGGAAAAATATTGGTAGACATCAGCAACAACCTCAAAATCAATCAATATCCAGAATCTAATGCAGAGTACCTTGCTCATTTGGTGCCAGGAGCCCACGTGGTAAAAGCATTTAACACCATCTCAGCCTGGG

Ensembl | human accession no.

ENSG00000127954

NCBI accession no.

NM_024636

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STEAP4(79689) , STEAP4(79689)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feng Wang et al.
Journal of cellular and molecular medicine, 21(12), 3298-3308 (2017-06-21)
The aim of this study was to investigate whether overexpression of STAMP2 improves insulin resistance by regulating angiogenesis in adipose tissues. The characteristics of diabetic mice were measured by serial metabolite and pathology tests. Samples were obtained from epididymal, subcutaneous
Yoo Jin Oh et al.
Molecular pharmacology, 94(6), 1401-1411 (2018-10-28)
Nonalcoholic fatty liver disease (NAFLD) is an increasingly studied condition that can progress to end-stage liver disease. Although NAFLD was first described in 1980, a complete understanding of the mechanism and causes of this disease is still lacking. Six-transmembrane protein
Hye Young Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12354-12366 (2020-07-29)
Although previous studies have shown that the administration of fibroblast growth factor 21 (FGF21) reverses hepatic steatosis, the mechanism by which FGF21 exerts a therapeutic effect on nonalcoholic fatty liver disease (NAFLD) is not yet entirely understood. We previously demonstrated
Sung Won Lee et al.
Bone research, 6, 20-20 (2018-07-14)
Free fatty acids (FFAs), which are elevated with metabolic syndrome, are considered the principal offender exerting lipotoxicity. Few previous studies have reported a causal relationship between FFAs and osteoarthritis pathogenesis. However, the molecular mechanism by which FFAs exert lipotoxicity and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service