Skip to Content
Merck
All Photos(1)

Key Documents

EHU058011

Sigma-Aldrich

MISSION® esiRNA

targeting human DPP4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATCCAAAGGCAGGAGCTGTGAATCCAACTGTAAAGTTCTTTGTTGTAAATACAGACTCTCTCAGCTCAGTCACCAATGCAACTTCCATACAAATCACTGCTCCTGCTTCTATGTTGATAGGGGATCACTACTTGTGTGATGTGACATGGGCAACACAAGAAAGAATTTCTTTGCAGTGGCTCAGGAGGATTCAGAACTATTCGGTCATGGATATTTGTGACTATGATGAATCCAGTGGAAGATGGAACTGCTTAGTGGCACGGCAACACATTGAAATGAGTACTACTGGCTGGGTTGGAAGATTTAGGCCTTCAGAACCTCATTTTACCCTTGATGGTAATAGCTTCTACAAGATCATCAGCAATGAAGAAGGTTACAGACACATTTGCTATTTCCAAATAGATAAAAAAGACTGCACATTTATTACAAAAGGCACCTGGGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Toshihiro Okamoto et al.
Biochemical and biophysical research communications, 504(2), 491-498 (2018-09-11)
Malignant pleural mesothelioma (MPM) is an aggressive malignancy arising from mesothelial lining of pleura. It is associated with a poor prognosis, partly due to the lack of a precise understanding of the molecular mechanisms associated with its malignant behavior. In
Ahmed A Al-Qahtani et al.
Oncotarget, 8(6), 9053-9066 (2017-01-25)
Middle East Respiratory Syndrome Corona Virus (MERS-CoV) is transmitted via the respiratory tract and causes severe Acute Respiratory Distress Syndrome by infecting lung epithelial cells and macrophages. Macrophages can readily recognize the virus and eliminate it. MERS-CoV infects cells via
Youichi Sato et al.
The Journal of endocrinology, 223(2), 133-142 (2014-08-15)
In a previous study, we demonstrated that dipeptidyl peptidase 4 (DPP4)-deficient rats were susceptible to reduced glomerular filtration rate as a result of streptozotocin (STZ)-induced diabetes. Therefore, we proposed that DPP4 might be responsible for the preservation of renal function.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service