Skip to Content
Merck
All Photos(1)

Key Documents

EHU050261

Sigma-Aldrich

MISSION® esiRNA

targeting human FRZB

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACTGTAGAGGGGCAAGCAGTGAACGCTGTAAATGTAAGCCTATTAGAGCTACACAGAAGACCTATTTCCGGAACAATTACAACTATGTCATTCGGGCTAAAGTTAAAGAGATAAAGACTAAGTGCCATGATGTGACTGCAGTAGTGGAGGTGAAGGAGATTCTAAAGTCCTCTCTGGTAAACATTCCACGGGACACTGTCAACCTCTATACCAGCTCTGGCTGCCTCTGCCCTCCACTTAATGTTAATGAGGAATATATCATCATGGGCTATGAAGATGAGGAACGTTCCAGATTACTCTTGGTGGAAGGCTCTATAGCTGAGAAGTGGAAGGATCGACTCGGTAAAAAAGTTAAGCGCTGGGATATGAAGCTTCGTCATCTTGGACTCAGTAAAAGTGATTCTAGCAATAGTGATTCCACTCAGAGTCAGAAGTCTGGCAGGAACTCGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

De-Zhi Zheng et al.
Current neurovascular research, 14(1), 32-38 (2017-04-07)
Periprosthetic osteolysis induced by wear particles can lead to aseptic loosening, one main reason of arthroplasty failure. However, the role of microRNA-130b (miR-130b) in particle-induced osteolysis (PIO) has not been explored yet. In this study, PIO models were established in
Liang-Jie Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 314-326 (2018-07-07)
Migration of placental extravillous trophoblast (EVT) cells into uterine decidua facilitates the establishment of blood circulation between mother and fetus and is modulated by EVT-decidual cell interaction. Poor or excessive EVT migration is associated with pregnancy complications such as preeclampsia
Julie J G Kephart et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 21(21), 4868-4880 (2015-06-14)
Rhabdomyosarcoma (RMS) is a soft tissue sarcoma associated with the skeletal muscle lineage. Of the two predominant subtypes, known as embryonal (eRMS) and alveolar (aRMS), aRMS has the poorer prognosis, with a five-year survival rate of <50%. The majority of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service