Skip to Content
Merck
All Photos(1)

Key Documents

EHU038321

Sigma-Aldrich

MISSION® esiRNA

targeting human GABRA3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGATCTGGACACCGGACACCTTCTTCCACAATGGCAAGAAATCAGTGGCTCATAACATGACCACGCCCAACAAGCTGCTCAGATTGGTGGACAACGGAACCCTCCTCTATACAATGAGGTTAACAATTCATGCTGAGTGTCCCATGCATTTGGAAGATTTTCCCATGGATGTGCATGCCTGCCCACTGAAGTTTGGAAGCTATGCCTATACAACAGCTGAAGTGGTTTATTCTTGGACTCTCGGAAAGAACAAATCCGTGGAAGTGGCACAGGATGGTTCTCGCTTGAACCAGTATGACCTTTTGGGCCATGTTGTTGGGACAGAGATAATCCGGTCTAGTACAGGAGAATATGTCGTCATGACAACCCACTTCCATCTCAAGCGAAAAATTGGCTACTTTGTGATCCAGACCTACTTGCCATGTATCATGACTGTCATTCTGTCACAAGTGTCGTTCTGGCTCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kiranmai Gumireddy et al.
Nature communications, 7, 10715-10715 (2016-02-13)
Metastasis is a critical event affecting breast cancer patient survival. To identify molecules contributing to the metastatic process, we analysed The Cancer Genome Atlas (TCGA) breast cancer data and identified 41 genes whose expression is inversely correlated with survival. Here
Manmei Long et al.
Molecular cancer, 16(1), 167-167 (2017-10-29)
MicroRNAs (miRNAs) can act as oncogenes or tumor suppressors by controlling cell proliferation, differentiation, metastasis and apoptosis, and miRNA dysregulation is involved in the development of pancreatic cancer (PC). Our previous study demonstrated that Gabra3 plays critical roles in cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service