All Photos(1)

Key Documents

COO/COA

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human ABL2

Sign Into View Organizational & Contract Pricing

All Photos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

description

Quality Level

100

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCGTCTGGAAGAAATACAGCCTTACAGTTGCTGTGAAAACATTGAAGGAAGATACCATGGAGGTAGAAGAATTCCTGAAAGAAGCTGCAGTAATGAAGGAAATCAAGCATCCTAATCTGGTACAACTTTTAGGTGTGTGTACTTTGGAGCCACCATTTTACATTGTGACTGAATACATGCCATACGGGAATTTGCTGGATTACCTCCGAGAATGCAACCGAGAAGAGGTGACTGCAGTTGTGCTGCTCTACATGGCCACTCAGATTTCTTCTGCAATGGAGTACTTAGAGAAGAAGAATTTCATCCATAGAGATCTTGCAGCTCGTAACTGCCTAGTGGGAGAAAACCATGTGGTAAAAGTGGCTGACTTTGGCTTAAGTAGATTGATGACTGGAGACACTTATACTGCTCATGCTGGAGCCAAATTTCCTATTAAGTGGACAGCACCAGAGAGTCTTGCCTACAATACCTTCTCAATTAAATCTGACGTCTGGGCTTTTGGGGTATT

Ensembl | human accession no.

ENSG00000143322

NCBI accession no.

NM_007314

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ABL2(27) , ABL2(27)

Related Categories

MISSION® esiRNA

General description

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Arg/Abl2 promotes invasion and attenuates proliferation of breast cancer in vivo.

H Gil-Henn et al.

Oncogene, 32(21), 2622-2630 (2012-07-11)

Tumor progression is a complex, multistep process involving accumulation of genetic aberrations and alterations in gene expression patterns leading to uncontrolled cell division, invasion into surrounding tissue and finally dissemination and metastasis. We have previously shown that the Arg/Abl2 non-receptor

Arginase II Promotes Macrophage Inflammatory Responses Through Mitochondrial Reactive Oxygen Species, Contributing to Insulin Resistance and Atherogenesis.

Xiu-Fen Ming et al.

Journal of the American Heart Association, 1(4), e000992-e000992 (2012-11-07)

Macrophage-mediated chronic inflammation is mechanistically linked to insulin resistance and atherosclerosis. Although arginase I is considered antiinflammatory, the role of arginase II (Arg-II) in macrophage function remains elusive. This study characterizes the role of Arg-II in macrophage inflammatory responses and

Vinexin family (SORBS) proteins play different roles in stiffness-sensing and contractile force generation.

Takafumi Ichikawa et al.

Journal of cell science, 130(20), 3517-3531 (2017-09-03)

Vinexin, c-Cbl associated protein (CAP) and Arg-binding protein 2 (ArgBP2) constitute an adaptor protein family called the vinexin (SORBS) family that is targeted to focal adhesions (FAs). Although numerous studies have focused on each of the SORBS proteins and partially

Arg mediates LPS-induced disruption of the pulmonary endothelial barrier.

Alicia N Rizzo et al.

Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)

Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine

Somatically mutated ABL1 is an actionable and essential NSCLC survival gene.

Ewelina Testoni et al.

EMBO molecular medicine, 8(2), 105-116 (2016-01-14)

The lack of actionable mutations in patients with non-small cell lung cancer (NSCLC) presents a significant hurdle in the design of targeted therapies for this disease. Here, we identify somatically mutated ABL1 as a genetic dependency that is required to

View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service