Skip to Content
Merck
All Photos(1)

Key Documents

EMU064851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACACGCAGCTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCAGCTTATGACCACGTGCGCAAGACCAGAGTGGCCATCAAGAAGATCAGCCCCTTTGAGCATCAAACCTACTGTCAGCGCACGCTGAGGGAGATCCAGATCTTGCTGCGATTCCGCCATGAGAATGTTATAGGCATCCGAGACATCCTCAGAGCGCCCACCCTGGAAGCCATGAGAGATGTTTACATTGTTCAGGACCTCATGGAGACAGACCTGTACAAGCTGCTTAAAAGCCAGCAGCTGAGCAATGACCACATCTGCTACTTCCTCTACCAGATCCTCCGGGGCCTCAAGTATATACACTCAGCCAATGTGCTGCACCGGGACCTGAAGCCTTCCAATCTGCTTATCAACACCACCTGCGA

Ensembl | mouse accession no.

ENSMUSG00000063065

NCBI accession no.

NM_011952

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... MAPK3(26417) , Mapk3(26417)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Juan Zhao et al.
PloS one, 9(10), e108005-e108005 (2014-10-11)
MicroRNA-21 (miR-21) plays an important role in the pathogenesis and progression of liver fibrosis. Here, we determined the serum and hepatic content of miR-21 in patients with liver cirrhosis and rats with dimethylnitrosamine-induced hepatic cirrhosis and examined the effects of
Michael C Brown et al.
Journal of virology, 88(22), 13149-13160 (2014-09-05)
Translation machinery is a major recipient of the principal mitogenic signaling networks involving Raf-ERK1/2 and phosphoinositol 3-kinase (PI3K)-mechanistic target of rapamycin (mTOR). Picornavirus internal ribosomal entry site (IRES)-mediated translation and cytopathogenic effects are susceptible to the status of such signaling
Tabish Hasan Khan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(7), 3644-3653 (2014-09-05)
CD40 plays dual immunoregulatory roles in Leishmania major infection and tumor regression. The functional duality emerges from CD40-induced reciprocal p38MAPK and ERK-1/2 phosphorylations. Because phosphotyrosine-based signaling in hematopoietic cells is regulated by the phosphotyrosine phosphatase SHP-1, which is not implied
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of
Ting Li et al.
Acta pharmacologica Sinica, 36(12), 1503-1513 (2015-11-26)
Platycodin D, the main saponin isolated from Chinese herb Platycodonis Radix, exhibits anticancer activities against various cancer cell lines. Here we evaluated its anticancer action against human hepatocellular carcinoma cells in vitro and in vivo, and elucidated the relationship between
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service