Skip to Content
Merck
All Photos(1)

Key Documents

EHU150531

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC29A4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGCCATACAACAGCTTCATCACGGACGTGGACTACCTGCATCACAAGTACCCAGGGACCTCCATCGTGTTTGACATGAGCCTCACCTACATCTTGGTGGCACTGGCAGCTGTCCTCCTGAACAACGTCCTGGTGGAGAGACTGACCCTGCACACCAGGATCACCGCAGGCTACCTCTTAGCCTTGGGCCCTCTCCTTTTTATCAGCATCTGCGACGTGTGGCTGCAGCTCTTCTCTCGGGACCAGGCCTACGCCATCAACCTGGCCGCTGTGGGCACCGTGGCCTTCGGCTGCACAGTGCAGCAATCCAGCTTCTACGGGTACACGGGGATGCTGCCCAAGCGGTACACGCAGGGGGTGATGACCGGGGAGAGCACGGCGGGCGTGATGATCTCTCTGAGCCGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Asmita Gyawali et al.
Biomolecules & therapeutics, 27(3), 290-301 (2019-04-12)
Paeonol has neuroprotective function, which could be useful for improving central nervous system disorder. The purpose of this study was to characterize the functional mechanism involved in brain transport of paeonol through blood-brain barrier (BBB). Brain transport of paeonol was
Jiaojiao Cong et al.
Journal of ethnopharmacology, 252, 112581-112581 (2020-01-23)
The herbs of Aconitum are the essential Traditional Chinese medicine and have played an indispensable role in many Asian countries for thousands of years to treat critical illnesses, and chronic, stubborn diseases. However, Aconitum may induce severe neurotoxicity and even

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service