Skip to Content
Merck
All Photos(1)

Key Documents

EHU065671

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPK

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCCAGAACGCTTCAGTTCTGCTCTGCAAGGATATATAATAACTGATTGGTGTGCCCGTTTAATAAAAGAATATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Taiyo Otoshi et al.
PloS one, 10(12), e0145769-e0145769 (2015-12-30)
Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a part of the ribonucleoprotein complex which regulates diverse biological events. While overexpression of hnRNP K has been shown to be related to tumorigenesis in several cancers, both the expression patterns and biological mechanisms
Agata Swiatkowska et al.
RNA biology, 17(10), 1402-1415 (2020-05-26)
The p53 protein is one of the transcription factors responsible for cell cycle regulation and prevention of cancer development. Its expression is regulated at the transcriptional, translational and post-translational levels. Recent years of research have shown that the 5' terminus
Xue Gong et al.
Oncotarget, 8(12), 18657-18669 (2017-04-21)
Clear cell renal cell carcinomas (ccRCC) show a broad range of clinical behavior, and prognostic biomarkers are needed to stratify patients for appropriate management. We sought to determine whether long intergenic non-coding RNAs (lincRNAs) might predict patient survival. Candidate prognostic
Diane Moujalled et al.
Human molecular genetics, 26(9), 1732-1746 (2017-03-24)
TAR DNA binding protein 43 (TDP-43) is a major disease-associated protein involved in the pathogenesis of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U). Our previous studies found a direct association between TDP-43 and heterogeneous nuclear
David Colognori et al.
Molecular cell, 74(1), 101-117 (2019-03-05)
During X-inactivation, Xist RNA spreads along an entire chromosome to establish silencing. However, the mechanism and functional RNA elements involved in spreading remain undefined. By performing a comprehensive endogenous Xist deletion screen, we identify Repeat B as crucial for spreading Xist

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service