Skip to Content
Merck
All Photos(1)

Key Documents

EHU009611

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTGATTTTAATGGCCACATCTAATCTCATTTCACATGAAAGAAGAAGTATATTTTAGAAATTTGTTAATGAGAGTAAAAGAAAATAAATGTGTATAGCTCAGTTTGGATAATTGGTCAAACAATTTTTTATCCAGTAGTAAAATATGTAACCATTGTCCCAGTAAAGAAAAATAACAAAAGTTGTAAAATGTATATTCTCCCTTTTATATTGCATCTGCTGTTACCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaori Huang et al.
Oncology letters, 17(3), 3425-3431 (2019-03-15)
Increasing number of microRNAs (miRNAs) have been reported to play an important role in the development and progression of non-small cell lung cancer (NSCLC). In particular, microRNA-497-5p (miR-497-5p) has been proposed as a tumor suppressor miRNA in human cancers. However
Hongxue Wu et al.
Biochemical and biophysical research communications, 514(3), 933-939 (2019-05-16)
Cancer-associated fibroblasts comprise the major stromal cell populations in gastric cancer, which is a significant contributor to cancer-related death worldwide. As a member of the serine protease family, HTRA1 is reportedly involved in malignant transformation of various tumor types. In
Long He et al.
Journal of cancer research and therapeutics, 14(7), 1519-1524 (2018-12-28)
The objective of the study is to investigate the role of basic fibroblast growth factor (bFGF) in sensitivity to cisplatin in non-small cell lung cancer (NSCLC) A549 cells and its effect on the stemness characteristics of NSCLC cells, revealing possible
Yantao Han et al.
Cell biology international, 41(12), 1296-1306 (2017-08-10)
Vascular smooth muscle cell (VSMC) proliferation is a major contributor to atherosclerosis. This study investigated the inhibitory effects of oleanolic acid (OA) against oxidized low-density lipoprotein (ox-LDL)-induced VSMC proliferation in A7r5 cells and explored underlying molecular mechanism. The cell proliferation
Ana M Ruiz Lopez et al.
The European journal of neuroscience, 46(1), 1663-1672 (2017-05-12)
Retinitis pigmentosa (RP) is a group of hereditary retinal diseases, characterised by photoreceptor cell loss. Despite a substantial understanding of the mechanisms leading to cell death, an effective therapeutic strategy is sought. Our laboratory has previously demonstrated the neuroprotective properties

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service