Skip to Content
Merck
All Photos(1)

Key Documents

EMU073291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nr1h3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTGACTTTGCCAAACAGCTCCCTGGCTTCCTACAGCTCAGCAGGGAGGACCAGATCGCCTTGCTGAAGACCTCTGCAATCGAGGTCATGCTTCTGGAGACGTCACGGAGGTACAACCCCGGCAGTGAGAGCATCACCTTCCTCAAGGACTTCAGTTACAACCGGGAAGACTTTGCCAAAGCAGGGCTGCAGGTGGAGTTCATCAACCCCATCTTTGAGTTCTCCAGAGCCATGAATGAGCTGCAACTCAATGATGCTGAGTTTGCTCTGCTCATTGCCATCAGCATCTTCTCTGCAGACCGGCCCAACGTGCAGGACCAGCTCCAAGTAGAGAGGCTGCAACACACATATGTGGAGGCCCTGCACGCCTACGTCTCCATCAACCACCCCCACGACCGACTGATGTTCCCACGGATGCTAATGAAGCTGGTGAGCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed
Mengyang Liu et al.
The Journal of biological chemistry, 290(23), 14418-14429 (2015-04-29)
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported
Limei Zhong et al.
Molecular immunology, 60(1), 32-43 (2014-04-22)
Liver X receptors (LXRs) are nuclear receptors that play an essential role in lipid and cholesterol metabolism. Emerging studies indicate a potential function for LXRs in regulating dendritic cell (DC)-dependent immune responses; however, the role of LXRs in DC differentiation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service