description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCAGTTTGCCAACGAGTTTAAAGTGAGAAGAATTAAGTTAGGATACACCCAGACAAACGTGGGCGAAGCGCTGGCTGCTGTCCACGGCTCAGAATTCAGTCAAACAACCATCTGTCGATTTGAAAACTTGCAGCTCAGTTTCAAAAATGCTTGTAAACTCAAAGCAATTTTATCCAAGTGGCTGGAGGAAGCTGAGCAGGTCGGAGCTTTGTACAATGAGAAGGTGGGAGCAAACGAAAGGAAGAGGAAACGGAGGACAACCATCAGTGTAGCTGCTAAGGATGCTCTGGAGAGACACTTCGGGGAGCACAGCAAGCCTTCCTCGCAGGAGATCATGCGGATGGCTGAAGAACTGAATCTCGAGAAAGAAGTAGTACGAGTGTGGTTCTGCAACCGAAGGCAGAGAGAAAAACG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... POU1F1(18736) , Pou1f1(18736)
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Protocols
Separation of Sulfur dioxide; Hydrogen sulfide; Carbonyl sulfide; Methanethiol; Ethanethiol; Dimethyl disulfide; Carbon disulfide
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service