Skip to Content
Merck
All Photos(1)

Key Documents

EMU045141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGGTGTGGGTCAGGAAATCACATCTTATACCGCTCGAGAGCCGGACACGTTCATGGATCAGAAGATCACGTATCGGATTTGGAGGGACACTGCCAACTGGCTGGAGATTAACCCAGAGACTGGTGCCATTTTCACGCGCGCTGAGATGGACAGAGAAGACGCTGAGCATGTGAAGAACAGCACATATGTAGCTCTCATCATCGCCACAGATGATGGTTCACCCATTGCCACTGGCACGGGCACTCTTCTCCTGGTCCTGTTAGACGTCAATGACAACGCTCCCATCCCAGAACCTCGAAACATGCAGTTCTGCCAGAGGAACCCACAGCCTCATATCATCACCATCTTGGATCCAGACCTTCCCCCCAACACGTCCCCCTTTACTGCTGAGCTAACCCATGGGGCCAGCGTCAACTGGACCATTGAGTATAATGACGCAGCTCAAGAATCTCTCATTTTGCAACCAAGAAAGGACTTAGAGATTGGCGAATACAAAATCCATCTCAAGCTCGCGGATAACCAGAACAAAGACCAGGTGACCACGTTGGACGTCCATGTGTGTGACTGTGAAGGGACGGTCAAC

Ensembl | mouse accession no.

ENSMUSG00000000303

NCBI accession no.

NM_009864

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CDH1(12550) , Cdh1(12550)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Chunyan Zhao et al.
Cancer research, 74(14), 3983-3994 (2014-05-17)
Triple-negative breast cancer (TNBC) is an aggressive clinical subtype accounting for up to 20% of all breast cancers, but its malignant determinants remain largely undefined. Here, we show that in TNBC the overexpression of Fra-1, a component of the transcription

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service