Skip to Content
Merck
All Photos(1)

Key Documents

EHU070611

Sigma-Aldrich

MISSION® esiRNA

targeting human RBBP8

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCCATGTCCGATACATAGAACAAACACATACTAAATTGGAGCACTCTGTGTGTGCAAATGAAATGAGAAAAGTTTCCAAGTCTTCAACTCATCCACAACATAATCCTAATGAAAATGAAATTCTAGTAGCTGACACTTATGACCAAAGTCAATCTCCAATGGCCAAAGCACATGGAACAAGCAGCTATACCCCTGATAAGTCATCTTTTAATTTAGCTACAGTTGTTGCTGAAACACTTGGACTTGGTGTTCAAGAAGAATCTGAAACTCAAGGTCCCATGAGCCCCCTTGGTGATGAGCTCTACCACTGTCTGGAAGGAAATCACAAGAAACAGCCTTTTGAGGAATCTACAAGAAATACTGAAGATAGTTTAAGATTTTCAGATTCTACTTCAAAGACTCCTCCTCAAGAAGAATTACCTACTCGAGTGTCATCTCCTGTATTTGGAGC

Ensembl | human accession no.

ENSG00000101773

NCBI accession no.

NM_203292

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RBBP8(5932) , RBBP8(5932)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Isabel Soria-Bretones et al.
Nature communications, 8(1), 113-113 (2017-07-26)
DNA breaks are complex DNA lesions that can be repaired by two alternative mechanisms: non-homologous end-joining and homologous recombination. The decision between them depends on the activation of the DNA resection machinery, which blocks non-homologous end-joining and stimulates recombination. On
Oriane Bombarde et al.
Molecular cancer therapeutics, 16(10), 2166-2177 (2017-06-15)
Poisons of topoisomerase II (TOP2) kill cancer cells by preventing religation of intermediate DNA breaks during the enzymatic process and thus by accumulating enzyme-drug-DNA complexes called TOP2 cleavage-complex (TOP2cc). F14512 is a highly cytotoxic polyamine-vectorized TOP2 inhibitor derived from etoposide
Li Du et al.
Cancer research, 80(19), 4212-4223 (2020-08-21)
Elevated expression of EZH2, the enzymatic subunit of polycomb repressive complex 2 (PRC2), often occurs in cancer. EZH2 expression results in the silencing of genes that suppress tumor formation and metastasis through trimethylation of histone H3 at lysine 27 (H3K27me3)
Jianfeng Shen et al.
Cancer research, 79(2), 311-319 (2018-11-30)
PARP inhibitors (PARPi) have shown remarkable therapeutic efficacy against BRCA1/2-mutant cancers through a synthetic lethal interaction. PARPi exert their therapeutic effects mainly through the blockade of ssDNA damage repair, which leads to the accumulation of toxic DNA double-strand breaks specifically
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service