Skip to Content
Merck
All Photos(1)

Key Documents

EHU025951

Sigma-Aldrich

MISSION® esiRNA

targeting human AR

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAAGCTGCAAGGTCTTCTTCAAAAGAGCCGCTGAAGGGAAACAGAAGTACCTGTGCGCCAGCAGAAATGATTGCACTATTGATAAATTCCGAAGGAAAAATTGTCCATCTTGTCGTCTTCGGAAATGTTATGAAGCAGGGATGACTCTGGGAGCCCGGAAGCTGAAGAAACTTGGTAATCTGAAACTACAGGAGGAAGGAGAGGCTTCCAGCACCACCAGCCCCACTGAGGAGACAACCCAGAAGCTGACAGTGTCACACATTGAAGGCTATGAATGTCAGCCCATCTTTCTGAATGTCCTGGAAGCCATTGAGCCAGGTGTAGTGTGTGCTGGACACGACAACAACCAGCCCGACTCCTTTGCAGCCTTGCTCTCTAGCCTCAATGAACTGGGAGAGAGACAGCTTGTACACGTGGTCAAGTGGGCCAAGGCCTTGCCTGGCTTCCGCAACTTACACGTGGACGACCAGATGGCTGTCATTCA

Ensembl | human accession no.

ENSG00000169083

NCBI accession no.

NM_000044

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AR(367) , AR(367)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chenfei Wang et al.
Nature cell biology, 20(5), 620-631 (2018-04-25)
H3K9me3-dependent heterochromatin is a major barrier of cell fate changes that must be reprogrammed after fertilization. However, the molecular details of these events are lacking in early embryos. Here, we map the genome-wide distribution of H3K9me3 modifications in mouse early
Masahito Ogasawara et al.
Experimental lung research, 42(5), 245-262 (2016-06-22)
The increasing amounts of evidence with abnormal aging process have been involved in the pathogenesis of chronic obstructive pulmonary disease (COPD) and idiopathic pulmonary fibrosis (IPF). Mice with deficient protein L-isoaspartate (D-aspartate) O-methyl transferase 1 (PCMT1) expression reveal acceleration of
Sekar Natesampillai et al.
Journal of immunology (Baltimore, Md. : 1950), 203(3), 718-724 (2019-06-14)
CD4 T cells from HIV-1 infected patients die at excessive rates compared to those from uninfected patients, causing immunodeficiency. We previously identified a dominant negative ligand that antagonizes the TRAIL-dependent pathway of cell death, which we called TRAILshort. Because the
Nathan R Zemke et al.
Cell host & microbe, 22(6), 789-800 (2017-12-15)
The N-terminal half of adenovirus e1a assembles multimeric complexes with host proteins that repress innate immune responses and force host cells into S-phase. In contrast, the functions of e1a's C-terminal interactions with FOXK, DCAF7, and CtBP are unknown. We found
Vasileios Chortis et al.
Endocrinology, 159(8), 2836-2849 (2018-06-01)
Adrenocortical carcinoma (ACC) is an aggressive malignancy with poor response to chemotherapy. In this study, we evaluated a potential new treatment target for ACC, focusing on the mitochondrial reduced form of NAD phosphate (NADPH) generator nicotinamide nucleotide transhydrogenase (NNT). NNT
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service