Skip to Content
Merck
All Photos(1)

Key Documents

EHU018071

Sigma-Aldrich

MISSION® esiRNA

targeting human SGPP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTGGCAGTACCCTCTTATATATGGACTGATTCTTATTCCCTGCTGGTGTTCTCTAGTTTGCCTAAGTAGAATTTACATGGGAATGCACTCTATTCTGGATATTATTGCTGGATTCCTATATACCATTTTAATCTTAGCTGTCTTCTATCCATTTGTGGACCTGATTGACAACTTCAACCAAACTCACAAATATGCTCCATTCATCATCATCGGGCTTCATTTAGCTTTGGGGATCTTTTCTTTCACTCTTGACACCTGGAGCACATCCCGAGGAGACACAGCCGAGATACTAGGAAGTGGTGCTGGAATTGCATGTGGATCTCATGTTACTTATAACATGGGTCTAGTATTAGATCCTTCTCTAGATACATTACCTTTAGCTGGGCCCCCCATTACTGTGACTCTGTTTGGAAAAGCCATATTGCGGATCCTCATAGGGATGGTATTTGTACTAATAATCAGAGATGTAATGAAAAAGATCACCATTCCTTTAGCCTGCAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service