Skip to Content
Merck
All Photos(1)

Key Documents

EHU156801

Sigma-Aldrich

MISSION® esiRNA

targeting human CSK

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTACCGAGGGAACAAAGTCGCCGTCAAGTGCATTAAGAACGACGCCACTGCCCAGGCCTTCCTGGCTGAAGCCTCAGTCATGACGCAACTGCGGCATAGCAACCTGGTGCAGCTCCTGGGCGTGATCGTGGAGGAGAAGGGCGGGCTCTACATCGTCACTGAGTACATGGCCAAGGGGAGCCTTGTGGACTACCTGCGGTCTAGGGGTCGGTCAGTGCTGGGCGGAGACTGTCTCCTCAAGTTCTCGCTAGATGTCTGCGAGGCCATGGAATACCTGGAGGGCAACAATTTCGTGCATCGAGACCTGGCTGCCCGCAATGTGCTGGTGTCTGAGGACAACGTGGCCAAGGTCAGCGACTTTGGTCTCACCAAGGAGGCGTCCAGCACCCAGGACACGGGCAAGCTGCCAGTCAAGTGGACAGCCCCTGAGGCCCTGAGAGAGAAGAAATTCTCCACTAAGTCTGACGTGTGGAGTTTCGGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gaofeng Fan et al.
The Journal of biological chemistry, 290(26), 15934-15947 (2015-04-22)
Despite significant evidence to the contrary, the view that phosphatases are "nonspecific" still pervades the field. Systems biology approaches to defining how signal transduction pathways are integrated at the level of whole organisms also often downplay the contribution of phosphatases
Dana C Danielson et al.
Biochemical and biophysical research communications, 463(4), 1135-1140 (2015-06-17)
RNA silencing is a gene regulatory and host defense mechanism whereby small RNA molecules are engaged by Argonaute (AGO) proteins, which facilitate gene knockdown of complementary mRNA targets. Small molecule inhibitors of AGO represent a convenient method for reversing this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service