Skip to Content
Merck
All Photos(1)

Key Documents

EHU113871

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT18

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kenneth H Yu et al.
Journal of proteome research, 8(3), 1565-1576 (2009-02-10)
A novel approach to pancreatic cancer biomarker discovery has been developed, which employs a stable isotope labeled proteome (SILAP) standard coupled with extensive multidimensional separation coupled with tandem mass spectrometry (MS/MS). Secreted proteins from CAPAN-2 human pancreatic cancer derived cells
Zahra Khalaj et al.
Iranian journal of basic medical sciences, 19(1), 34-42 (2016-04-21)
The application of stem cells holds great promises in cell transplants. Considering the lack of optimal in vitro model for hepatogenic differentiation, this study was designed to examine the effects of laminin matrix on the improvement of in vitro differentiation
Christian Lehmann et al.
International journal of oncology, 41(6), 1932-1942 (2012-10-09)
The tumor-initiating capacity of primary human breast cancer cells is maintained in vitro by culturing these cells as spheres/aggregates. Inoculation of small cell numbers derived from these non-adherent cultures leads to rapid xenograft tumor formation in mice. Accordingly, injection of
Hyejung Jung et al.
Molecular and cellular biochemistry, 423(1-2), 21-28 (2016-11-04)
During epithelial-mesenchymal transition (EMT), epithelial cells lose key phenotypic markers (e.g., E-cadherin and cytokeratin 18) and acquire mesenchymal markers (e.g., N-cadherin and vimentin). Although the loss of cytokeratin 18 is a hallmark of EMT, the regulatory role of cytokeratin 18
Hyunee Yim et al.
Journal of Korean medical science, 21(4), 652-655 (2006-08-08)
Cytokeratin 18 (CK18) protein was identified as an airway epithelial cell autoantigen associated with nonallergic asthma. Cleavage of CK18 protein by caspase-3 is a marker of early apoptosis in epithelial cells. It has been shown that the expression of active

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service