Skip to Content
Merck
All Photos(1)

Key Documents

EHU055991

Sigma-Aldrich

MISSION® esiRNA

targeting human UBIAD1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTGTGGACCGAATCTTGGAGCCGCAGGATGTCGTCCGGTTCGGAGTCTTCCTCTACACGTTGGGCTGCGTCTGTGCCGCTTGCCTCTACTACCTGTCCCCTCTGAAACTGGAGCACTTGGCTCTTATCTACTTTGGAGGCCTGTCTGGCTCCTTTCTCTACACAGGAGGAATTGGATTCAAGTACGTGGCTCTGGGAGACCTCATCATCCTCATCACTTTTGGCCCGCTGGCTGTGATGTTCGCCTACGCCATCCAGGTGGGGTCCCTGGCCATCTTCCCACTGGTCTATGCCATCCCCCTCGCCCTCAGCACCGAGGCCATTCTCCATTCCAACAACACCAGGGACATGGAGTCCGACCGGGAGGCTGGTATCGTCACGCTGGCCATCCTCATCGGCCCCACGTTCTCCTACATTCTCTACAACACACTGCTCTTCCTGCCCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bingju Yan et al.
Molecular medicine reports, 16(5), 6910-6915 (2017-09-14)
UbiA prenyltransferase domain containing 1 (UBIAD1) is closely associated with cardiovascular diseases. However, at the cellular level, little is known about how UBIAD1 is expressed and functions in cardiomyocyte hypertrophy. The aim of the present study was to investigate the expression
Liang Yan et al.
American journal of translational research, 12(10), 6277-6289 (2020-11-17)
Exosome-encapsulated microRNAs (miRNAs) have been identified as potential cancer biomarkers and pro-tumorigenic mediators for several cancers. However, the miRNA profiling in BCa-Exo (exosomes from plasma of patients with bladder cancer) has not yet been explored. Hence, the aim of this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service